Incidental Mutation 'R9404:Ptpn23'
ID 711416
Institutional Source Beutler Lab
Gene Symbol Ptpn23
Ensembl Gene ENSMUSG00000036057
Gene Name protein tyrosine phosphatase, non-receptor type 23
Synonyms PTP-TD14
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9404 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 110385082-110408213 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110386957 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1277 (N1277S)
Ref Sequence ENSEMBL: ENSMUSP00000039580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040021] [ENSMUST00000098350]
AlphaFold Q6PB44
PDB Structure MONA SH3C IN COMPLEX [X-RAY DIFFRACTION]
Predicted Effect
SMART Domains Protein: ENSMUSP00000039580
Gene: ENSMUSG00000036057
AA Change: N1277S

DomainStartEndE-ValueType
BRO1 8 384 5.94e-159 SMART
Pfam:ALIX_LYPXL_bnd 416 704 1.4e-64 PFAM
low complexity region 715 728 N/A INTRINSIC
low complexity region 774 785 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 905 928 N/A INTRINSIC
internal_repeat_1 929 942 8.2e-5 PROSPERO
internal_repeat_1 943 956 8.2e-5 PROSPERO
low complexity region 977 1018 N/A INTRINSIC
low complexity region 1040 1061 N/A INTRINSIC
low complexity region 1088 1106 N/A INTRINSIC
low complexity region 1128 1160 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
low complexity region 1225 1235 N/A INTRINSIC
PTPc 1246 1510 1.28e-92 SMART
low complexity region 1576 1587 N/A INTRINSIC
low complexity region 1589 1643 N/A INTRINSIC
Blast:PTPc 1644 1673 9e-8 BLAST
low complexity region 1675 1689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098350
SMART Domains Protein: ENSMUSP00000095953
Gene: ENSMUSG00000032485

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
Pfam:Patched 279 504 4.7e-24 PFAM
Pfam:Sterol-sensing 308 459 7.6e-54 PFAM
transmembrane domain 515 534 N/A INTRINSIC
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 741 751 N/A INTRINSIC
WD40 765 802 1.79e-1 SMART
low complexity region 847 865 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
WD40 953 990 9.86e1 SMART
low complexity region 1050 1060 N/A INTRINSIC
WD40 1062 1102 4.18e-2 SMART
WD40 1105 1143 5.64e-8 SMART
WD40 1147 1183 2.4e-1 SMART
WD40 1186 1223 2.56e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200531
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the non-receptor type protein-tyrosine phosphatase family. The encoded protein may be involved in the regulation of small nuclear ribonucleo protein assembly and pre-mRNA splicing by modifying the survival motor neuron (SMN) complex. The encoded protein additionally plays a role in ciliogenesis and is part of endosomal sorting complex required for transport (ESCRT) pathways. This gene may serve a tumor suppressor function. [provided by RefSeq, Jul 2016]
PHENOTYPE: Embryos homozygous for a gene trap allele are significantly growth retarded and fail to reach the E8.5 stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 T C 4: 106,758,312 K314R possibly damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Atad5 T C 11: 80,114,238 V1167A probably damaging Het
Bbs12 T C 3: 37,319,408 S2P probably damaging Het
Cdh11 A T 8: 102,679,622 L73Q probably damaging Het
Cdk15 A G 1: 59,289,755 E274G possibly damaging Het
Col27a1 T C 4: 63,275,941 V845A possibly damaging Het
Cyp3a11 T C 5: 145,862,448 T310A probably benign Het
Efcab5 G A 11: 77,132,108 T593I probably damaging Het
Ewsr1 A G 11: 5,072,940 M388T unknown Het
Fat2 A G 11: 55,253,522 probably null Het
Gm8225 T A 17: 26,543,060 I75N probably damaging Het
Gsap A G 5: 21,269,921 Y526C probably damaging Het
Hk1 T A 10: 62,296,080 I203F possibly damaging Het
Insl5 T C 4: 103,018,338 R72G probably benign Het
Iqcb1 T C 16: 36,851,270 V321A probably damaging Het
Iqcd A C 5: 120,600,536 T140P Het
Kcnt2 T A 1: 140,425,369 I272K probably damaging Het
Klhl25 A C 7: 75,865,405 I20L probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrba T C 3: 86,297,917 V356A probably damaging Het
Mast4 A G 13: 102,751,425 Y1159H probably damaging Het
Mavs T A 2: 131,241,898 L105Q probably damaging Het
Megf6 T A 4: 154,263,768 C902S Het
Mgea5 CTCGGGTC CTC 19: 45,754,657 probably null Het
Mmp17 A G 5: 129,605,677 D460G possibly damaging Het
Myh2 G T 11: 67,179,628 A466S probably damaging Het
Neb T C 2: 52,257,776 N2744D probably damaging Het
Olfr1197 T A 2: 88,729,207 M131L probably benign Het
Olfr169 C T 16: 19,565,981 V301M probably benign Het
Olfr213 T G 6: 116,540,747 I98S probably damaging Het
Olfr446 T C 6: 42,927,816 V195A probably benign Het
Olfr541 T A 7: 140,704,809 L186H probably damaging Het
Olfr972 A T 9: 39,873,412 I46F possibly damaging Het
Parpbp A G 10: 88,114,549 V323A possibly damaging Het
Pax5 G A 4: 44,645,565 P255S possibly damaging Het
Pcdhga2 A G 18: 37,670,014 T304A probably benign Het
Pcsk1 T G 13: 75,132,223 S722R probably benign Het
Pcsk9 C A 4: 106,454,526 R218L probably damaging Het
Pds5a T A 5: 65,618,964 I96F probably damaging Het
Pkdrej C A 15: 85,819,069 V889L probably benign Het
Plekhh2 A T 17: 84,571,040 probably null Het
Pnn A G 12: 59,071,972 E447G probably damaging Het
Ppp2r3a A G 9: 101,148,641 L289P probably damaging Het
Ppp6r2 A G 15: 89,268,550 H298R probably benign Het
Pus10 T A 11: 23,711,202 F263L possibly damaging Het
Rexo5 A G 7: 119,801,319 Y109C probably damaging Het
Rnf185 A T 11: 3,432,615 C23* probably null Het
Runx1 T C 16: 92,689,027 N140D probably benign Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Scn9a G A 2: 66,526,696 T1087I probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 TC TCAGCCACGGGGACCAGCCC 7: 126,467,599 probably benign Het
Slc7a11 T C 3: 50,381,039 H350R possibly damaging Het
Spaca6 T C 17: 17,837,538 C155R probably damaging Het
Spire2 C T 8: 123,363,338 R580* probably null Het
Srgap3 A T 6: 112,729,655 M851K probably benign Het
Themis A G 10: 28,789,747 D602G probably benign Het
Tmem56 T C 3: 121,235,082 N52S probably benign Het
Trak2 T C 1: 58,921,137 T236A possibly damaging Het
Trrap T C 5: 144,815,415 C1709R possibly damaging Het
Ttn A T 2: 76,754,156 S22203T probably damaging Het
Ube3a A G 7: 59,287,015 T701A probably damaging Het
Ufl1 T C 4: 25,275,912 I164V probably benign Het
Vcpip1 T C 1: 9,747,631 T176A probably damaging Het
Virma T A 4: 11,513,626 D493E probably benign Het
Vmn2r77 T A 7: 86,802,039 W378R probably benign Het
Vps13b A T 15: 35,876,419 T2799S probably damaging Het
Vps8 T C 16: 21,608,177 S1337P probably benign Het
Zcchc6 A T 13: 59,799,887 N873K probably benign Het
Zfp235 A T 7: 24,140,437 I94F possibly damaging Het
Zfp3 A G 11: 70,772,540 K442E probably damaging Het
Zfp418 A T 7: 7,182,105 I356F possibly damaging Het
Zfp790 G A 7: 29,825,760 G68S probably benign Het
Other mutations in Ptpn23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Ptpn23 APN 9 110388106 missense probably benign 0.00
IGL01462:Ptpn23 APN 9 110408107 missense probably benign 0.33
IGL01666:Ptpn23 APN 9 110386545 missense possibly damaging 0.95
IGL01757:Ptpn23 APN 9 110391636 missense probably damaging 1.00
IGL02402:Ptpn23 APN 9 110393713 missense possibly damaging 0.81
IGL02891:Ptpn23 APN 9 110388020 nonsense probably null
peony UTSW 9 110386507 missense probably damaging 0.97
FR4449:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4548:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4737:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
FR4976:Ptpn23 UTSW 9 110387633 missense probably benign 0.15
R0111:Ptpn23 UTSW 9 110385623 missense probably damaging 0.97
R0377:Ptpn23 UTSW 9 110388132 missense possibly damaging 0.73
R0432:Ptpn23 UTSW 9 110389010 critical splice donor site probably null
R0456:Ptpn23 UTSW 9 110389793 splice site probably null
R0457:Ptpn23 UTSW 9 110386293 missense possibly damaging 0.95
R0988:Ptpn23 UTSW 9 110388777 missense probably benign 0.02
R1072:Ptpn23 UTSW 9 110386595 missense probably benign 0.29
R1769:Ptpn23 UTSW 9 110391678 missense possibly damaging 0.89
R1859:Ptpn23 UTSW 9 110388870 missense possibly damaging 0.92
R1891:Ptpn23 UTSW 9 110393800 missense possibly damaging 0.74
R1915:Ptpn23 UTSW 9 110386507 missense probably damaging 0.97
R1954:Ptpn23 UTSW 9 110386325 missense probably damaging 0.99
R2299:Ptpn23 UTSW 9 110392513 missense possibly damaging 0.72
R2431:Ptpn23 UTSW 9 110386279 nonsense probably null
R2445:Ptpn23 UTSW 9 110387632 missense possibly damaging 0.79
R3014:Ptpn23 UTSW 9 110389695 missense probably benign
R3820:Ptpn23 UTSW 9 110389794 unclassified probably benign
R3904:Ptpn23 UTSW 9 110389245 missense probably benign 0.11
R4441:Ptpn23 UTSW 9 110392725 missense probably benign 0.01
R4464:Ptpn23 UTSW 9 110386813 missense probably damaging 1.00
R4709:Ptpn23 UTSW 9 110388856 missense possibly damaging 0.86
R4810:Ptpn23 UTSW 9 110389136 missense possibly damaging 0.93
R4937:Ptpn23 UTSW 9 110392738 missense probably benign 0.09
R5023:Ptpn23 UTSW 9 110388556 missense probably benign 0.00
R5057:Ptpn23 UTSW 9 110388556 missense probably benign 0.00
R5065:Ptpn23 UTSW 9 110398188 missense possibly damaging 0.91
R5143:Ptpn23 UTSW 9 110385438 unclassified probably benign
R5370:Ptpn23 UTSW 9 110385701 missense possibly damaging 0.79
R5534:Ptpn23 UTSW 9 110392741 missense possibly damaging 0.95
R5715:Ptpn23 UTSW 9 110387075 missense probably damaging 1.00
R5914:Ptpn23 UTSW 9 110385443 unclassified probably benign
R6122:Ptpn23 UTSW 9 110387825 unclassified probably benign
R6155:Ptpn23 UTSW 9 110387781 unclassified probably benign
R6156:Ptpn23 UTSW 9 110387781 unclassified probably benign
R6296:Ptpn23 UTSW 9 110393826 missense probably damaging 0.96
R6755:Ptpn23 UTSW 9 110389787 missense probably damaging 0.98
R7018:Ptpn23 UTSW 9 110385816 missense possibly damaging 0.89
R7126:Ptpn23 UTSW 9 110388744 missense probably benign 0.00
R7181:Ptpn23 UTSW 9 110385257 missense unknown
R7578:Ptpn23 UTSW 9 110387608 missense probably benign 0.33
R7675:Ptpn23 UTSW 9 110387026 nonsense probably null
R7776:Ptpn23 UTSW 9 110386300 missense possibly damaging 0.89
R7797:Ptpn23 UTSW 9 110393807 missense possibly damaging 0.86
R8071:Ptpn23 UTSW 9 110388199 missense probably damaging 0.98
R8071:Ptpn23 UTSW 9 110388200 missense possibly damaging 0.93
R8954:Ptpn23 UTSW 9 110392500 missense probably damaging 1.00
R9063:Ptpn23 UTSW 9 110389625 missense possibly damaging 0.85
R9208:Ptpn23 UTSW 9 110408033 critical splice donor site probably null
R9380:Ptpn23 UTSW 9 110392513 missense possibly damaging 0.72
R9570:Ptpn23 UTSW 9 110398149 missense probably damaging 0.96
X0062:Ptpn23 UTSW 9 110387707 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCATGAGCCAGAAATCTGCAG -3'
(R):5'- TACCAAGGTAGATGCAGCTG -3'

Sequencing Primer
(F):5'- GCCAGAAATCTGCAGCTGTG -3'
(R):5'- CTAATTGAGCAGGACCCCTATG -3'
Posted On 2022-05-16