Incidental Mutation 'R9404:Ewsr1'
ID 711422
Institutional Source Beutler Lab
Gene Symbol Ewsr1
Ensembl Gene ENSMUSG00000009079
Gene Name Ewing sarcoma breakpoint region 1
Synonyms Ews
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9404 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 5069689-5099266 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 5072940 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 388 (M388T)
Ref Sequence ENSEMBL: ENSMUSP00000078867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073308] [ENSMUST00000079949] [ENSMUST00000102930]
AlphaFold Q61545
Predicted Effect unknown
Transcript: ENSMUST00000073308
AA Change: M351T
SMART Domains Protein: ENSMUSP00000073034
Gene: ENSMUSG00000009079
AA Change: M351T

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 5.91e-6 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 91 121 N/A INTRINSIC
internal_repeat_1 155 170 5.91e-6 PROSPERO
low complexity region 187 211 N/A INTRINSIC
low complexity region 213 266 N/A INTRINSIC
low complexity region 296 315 N/A INTRINSIC
RRM 324 405 8.38e-17 SMART
low complexity region 416 475 N/A INTRINSIC
ZnF_RBZ 482 508 6.22e-7 SMART
low complexity region 512 586 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000079949
AA Change: M388T
SMART Domains Protein: ENSMUSP00000078867
Gene: ENSMUSG00000009079
AA Change: M388T

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 2.98e-6 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 91 121 N/A INTRINSIC
internal_repeat_1 155 170 2.98e-6 PROSPERO
low complexity region 187 211 N/A INTRINSIC
low complexity region 213 266 N/A INTRINSIC
low complexity region 300 331 N/A INTRINSIC
low complexity region 335 356 N/A INTRINSIC
RRM 361 442 8.38e-17 SMART
low complexity region 453 512 N/A INTRINSIC
ZnF_RBZ 519 545 6.22e-7 SMART
low complexity region 549 623 N/A INTRINSIC
low complexity region 629 639 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000102930
AA Change: M394T
SMART Domains Protein: ENSMUSP00000099994
Gene: ENSMUSG00000009079
AA Change: M394T

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
internal_repeat_1 26 41 3.23e-6 PROSPERO
low complexity region 51 71 N/A INTRINSIC
low complexity region 97 127 N/A INTRINSIC
internal_repeat_1 161 176 3.23e-6 PROSPERO
low complexity region 193 217 N/A INTRINSIC
low complexity region 219 272 N/A INTRINSIC
low complexity region 306 337 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
RRM 367 448 8.38e-17 SMART
low complexity region 459 518 N/A INTRINSIC
ZnF_RBZ 525 551 6.22e-7 SMART
low complexity region 555 629 N/A INTRINSIC
low complexity region 635 645 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit postnatal lethality, defective pre-B cell development, apoptosis of gametes and arrest in gamete maturation due to reduced meiotic recombination leading to infertility, kyphosis, lymphopenia, muscular atrophy, and hypersensitivity to ionizing radiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 T C 4: 106,758,312 K314R possibly damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Atad5 T C 11: 80,114,238 V1167A probably damaging Het
Bbs12 T C 3: 37,319,408 S2P probably damaging Het
Cdh11 A T 8: 102,679,622 L73Q probably damaging Het
Cdk15 A G 1: 59,289,755 E274G possibly damaging Het
Col27a1 T C 4: 63,275,941 V845A possibly damaging Het
Cyp3a11 T C 5: 145,862,448 T310A probably benign Het
Efcab5 G A 11: 77,132,108 T593I probably damaging Het
Fat2 A G 11: 55,253,522 probably null Het
Gm8225 T A 17: 26,543,060 I75N probably damaging Het
Gsap A G 5: 21,269,921 Y526C probably damaging Het
Hk1 T A 10: 62,296,080 I203F possibly damaging Het
Insl5 T C 4: 103,018,338 R72G probably benign Het
Iqcb1 T C 16: 36,851,270 V321A probably damaging Het
Iqcd A C 5: 120,600,536 T140P Het
Kcnt2 T A 1: 140,425,369 I272K probably damaging Het
Klhl25 A C 7: 75,865,405 I20L probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrba T C 3: 86,297,917 V356A probably damaging Het
Mast4 A G 13: 102,751,425 Y1159H probably damaging Het
Mavs T A 2: 131,241,898 L105Q probably damaging Het
Megf6 T A 4: 154,263,768 C902S Het
Mgea5 CTCGGGTC CTC 19: 45,754,657 probably null Het
Mmp17 A G 5: 129,605,677 D460G possibly damaging Het
Myh2 G T 11: 67,179,628 A466S probably damaging Het
Neb T C 2: 52,257,776 N2744D probably damaging Het
Olfr1197 T A 2: 88,729,207 M131L probably benign Het
Olfr169 C T 16: 19,565,981 V301M probably benign Het
Olfr213 T G 6: 116,540,747 I98S probably damaging Het
Olfr446 T C 6: 42,927,816 V195A probably benign Het
Olfr541 T A 7: 140,704,809 L186H probably damaging Het
Olfr972 A T 9: 39,873,412 I46F possibly damaging Het
Parpbp A G 10: 88,114,549 V323A possibly damaging Het
Pax5 G A 4: 44,645,565 P255S possibly damaging Het
Pcdhga2 A G 18: 37,670,014 T304A probably benign Het
Pcsk1 T G 13: 75,132,223 S722R probably benign Het
Pcsk9 C A 4: 106,454,526 R218L probably damaging Het
Pds5a T A 5: 65,618,964 I96F probably damaging Het
Pkdrej C A 15: 85,819,069 V889L probably benign Het
Plekhh2 A T 17: 84,571,040 probably null Het
Pnn A G 12: 59,071,972 E447G probably damaging Het
Ppp2r3a A G 9: 101,148,641 L289P probably damaging Het
Ppp6r2 A G 15: 89,268,550 H298R probably benign Het
Ptpn23 T C 9: 110,386,957 N1277S Het
Pus10 T A 11: 23,711,202 F263L possibly damaging Het
Rexo5 A G 7: 119,801,319 Y109C probably damaging Het
Rnf185 A T 11: 3,432,615 C23* probably null Het
Runx1 T C 16: 92,689,027 N140D probably benign Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Scn9a G A 2: 66,526,696 T1087I probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 TC TCAGCCACGGGGACCAGCCC 7: 126,467,599 probably benign Het
Slc7a11 T C 3: 50,381,039 H350R possibly damaging Het
Spaca6 T C 17: 17,837,538 C155R probably damaging Het
Spire2 C T 8: 123,363,338 R580* probably null Het
Srgap3 A T 6: 112,729,655 M851K probably benign Het
Themis A G 10: 28,789,747 D602G probably benign Het
Tmem56 T C 3: 121,235,082 N52S probably benign Het
Trak2 T C 1: 58,921,137 T236A possibly damaging Het
Trrap T C 5: 144,815,415 C1709R possibly damaging Het
Ttn A T 2: 76,754,156 S22203T probably damaging Het
Ube3a A G 7: 59,287,015 T701A probably damaging Het
Ufl1 T C 4: 25,275,912 I164V probably benign Het
Vcpip1 T C 1: 9,747,631 T176A probably damaging Het
Virma T A 4: 11,513,626 D493E probably benign Het
Vmn2r77 T A 7: 86,802,039 W378R probably benign Het
Vps13b A T 15: 35,876,419 T2799S probably damaging Het
Vps8 T C 16: 21,608,177 S1337P probably benign Het
Zcchc6 A T 13: 59,799,887 N873K probably benign Het
Zfp235 A T 7: 24,140,437 I94F possibly damaging Het
Zfp3 A G 11: 70,772,540 K442E probably damaging Het
Zfp418 A T 7: 7,182,105 I356F possibly damaging Het
Zfp790 G A 7: 29,825,760 G68S probably benign Het
Other mutations in Ewsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02000:Ewsr1 APN 11 5088077 missense probably damaging 1.00
IGL02218:Ewsr1 APN 11 5070668 missense unknown
IGL02288:Ewsr1 APN 11 5093689 missense possibly damaging 0.53
IGL02410:Ewsr1 APN 11 5093863 splice site probably benign
R0485:Ewsr1 UTSW 11 5070737 splice site probably benign
R0570:Ewsr1 UTSW 11 5085935 missense possibly damaging 0.80
R1546:Ewsr1 UTSW 11 5078574 unclassified probably benign
R1688:Ewsr1 UTSW 11 5072870 missense unknown
R2074:Ewsr1 UTSW 11 5071555 missense unknown
R2158:Ewsr1 UTSW 11 5091450 splice site probably benign
R2326:Ewsr1 UTSW 11 5091857 critical splice donor site probably null
R2880:Ewsr1 UTSW 11 5078523 unclassified probably benign
R2881:Ewsr1 UTSW 11 5078523 unclassified probably benign
R2882:Ewsr1 UTSW 11 5078523 unclassified probably benign
R3965:Ewsr1 UTSW 11 5083476 missense unknown
R4743:Ewsr1 UTSW 11 5083541 missense unknown
R4782:Ewsr1 UTSW 11 5070423 missense unknown
R5023:Ewsr1 UTSW 11 5088054 missense possibly damaging 0.83
R5194:Ewsr1 UTSW 11 5082355 missense unknown
R5422:Ewsr1 UTSW 11 5080668 intron probably benign
R5790:Ewsr1 UTSW 11 5082263 intron probably benign
R6993:Ewsr1 UTSW 11 5071573 missense probably benign 0.23
R7719:Ewsr1 UTSW 11 5085900 missense unknown
R9104:Ewsr1 UTSW 11 5091367 missense unknown
R9380:Ewsr1 UTSW 11 5093730 missense possibly damaging 0.96
R9613:Ewsr1 UTSW 11 5078924 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCCTAAGTGAGCAGAATCC -3'
(R):5'- TCTCCTGGGGAAGACTTGAC -3'

Sequencing Primer
(F):5'- CCTAAGTGAGCAGAATCCAGAGTGAC -3'
(R):5'- TAAACTGTCTGTGGCATGAGAC -3'
Posted On 2022-05-16