Incidental Mutation 'R9404:Efcab5'
ID 711427
Institutional Source Beutler Lab
Gene Symbol Efcab5
Ensembl Gene ENSMUSG00000050944
Gene Name EF-hand calcium binding domain 5
Synonyms 4930563A03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R9404 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 77089915-77188968 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 77132108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 593 (T593I)
Ref Sequence ENSEMBL: ENSMUSP00000118152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108400] [ENSMUST00000130901]
AlphaFold A0JP43
Predicted Effect probably damaging
Transcript: ENSMUST00000108400
AA Change: T729I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104037
Gene: ENSMUSG00000050944
AA Change: T729I

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 210 219 N/A INTRINSIC
internal_repeat_1 250 352 2.42e-20 PROSPERO
internal_repeat_1 354 452 2.42e-20 PROSPERO
low complexity region 498 513 N/A INTRINSIC
coiled coil region 749 776 N/A INTRINSIC
GAF 877 1066 1.78e-2 SMART
low complexity region 1235 1245 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130901
AA Change: T593I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118152
Gene: ENSMUSG00000050944
AA Change: T593I

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
internal_repeat_1 114 216 1.89e-19 PROSPERO
internal_repeat_1 218 316 1.89e-19 PROSPERO
low complexity region 362 377 N/A INTRINSIC
coiled coil region 613 640 N/A INTRINSIC
GAF 741 930 1.78e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 T C 4: 106,758,312 K314R possibly damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Atad5 T C 11: 80,114,238 V1167A probably damaging Het
Bbs12 T C 3: 37,319,408 S2P probably damaging Het
Cdh11 A T 8: 102,679,622 L73Q probably damaging Het
Cdk15 A G 1: 59,289,755 E274G possibly damaging Het
Col27a1 T C 4: 63,275,941 V845A possibly damaging Het
Cyp3a11 T C 5: 145,862,448 T310A probably benign Het
Ewsr1 A G 11: 5,072,940 M388T unknown Het
Fat2 A G 11: 55,253,522 probably null Het
Gm8225 T A 17: 26,543,060 I75N probably damaging Het
Gsap A G 5: 21,269,921 Y526C probably damaging Het
Hk1 T A 10: 62,296,080 I203F possibly damaging Het
Insl5 T C 4: 103,018,338 R72G probably benign Het
Iqcb1 T C 16: 36,851,270 V321A probably damaging Het
Iqcd A C 5: 120,600,536 T140P Het
Kcnt2 T A 1: 140,425,369 I272K probably damaging Het
Klhl25 A C 7: 75,865,405 I20L probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrba T C 3: 86,297,917 V356A probably damaging Het
Mast4 A G 13: 102,751,425 Y1159H probably damaging Het
Mavs T A 2: 131,241,898 L105Q probably damaging Het
Megf6 T A 4: 154,263,768 C902S Het
Mgea5 CTCGGGTC CTC 19: 45,754,657 probably null Het
Mmp17 A G 5: 129,605,677 D460G possibly damaging Het
Myh2 G T 11: 67,179,628 A466S probably damaging Het
Neb T C 2: 52,257,776 N2744D probably damaging Het
Olfr1197 T A 2: 88,729,207 M131L probably benign Het
Olfr169 C T 16: 19,565,981 V301M probably benign Het
Olfr213 T G 6: 116,540,747 I98S probably damaging Het
Olfr446 T C 6: 42,927,816 V195A probably benign Het
Olfr541 T A 7: 140,704,809 L186H probably damaging Het
Olfr972 A T 9: 39,873,412 I46F possibly damaging Het
Parpbp A G 10: 88,114,549 V323A possibly damaging Het
Pax5 G A 4: 44,645,565 P255S possibly damaging Het
Pcdhga2 A G 18: 37,670,014 T304A probably benign Het
Pcsk1 T G 13: 75,132,223 S722R probably benign Het
Pcsk9 C A 4: 106,454,526 R218L probably damaging Het
Pds5a T A 5: 65,618,964 I96F probably damaging Het
Pkdrej C A 15: 85,819,069 V889L probably benign Het
Plekhh2 A T 17: 84,571,040 probably null Het
Pnn A G 12: 59,071,972 E447G probably damaging Het
Ppp2r3a A G 9: 101,148,641 L289P probably damaging Het
Ppp6r2 A G 15: 89,268,550 H298R probably benign Het
Ptpn23 T C 9: 110,386,957 N1277S Het
Pus10 T A 11: 23,711,202 F263L possibly damaging Het
Rexo5 A G 7: 119,801,319 Y109C probably damaging Het
Rnf185 A T 11: 3,432,615 C23* probably null Het
Runx1 T C 16: 92,689,027 N140D probably benign Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Scn9a G A 2: 66,526,696 T1087I probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 TC TCAGCCACGGGGACCAGCCC 7: 126,467,599 probably benign Het
Slc7a11 T C 3: 50,381,039 H350R possibly damaging Het
Spaca6 T C 17: 17,837,538 C155R probably damaging Het
Spire2 C T 8: 123,363,338 R580* probably null Het
Srgap3 A T 6: 112,729,655 M851K probably benign Het
Themis A G 10: 28,789,747 D602G probably benign Het
Tmem56 T C 3: 121,235,082 N52S probably benign Het
Trak2 T C 1: 58,921,137 T236A possibly damaging Het
Trrap T C 5: 144,815,415 C1709R possibly damaging Het
Ttn A T 2: 76,754,156 S22203T probably damaging Het
Ube3a A G 7: 59,287,015 T701A probably damaging Het
Ufl1 T C 4: 25,275,912 I164V probably benign Het
Vcpip1 T C 1: 9,747,631 T176A probably damaging Het
Virma T A 4: 11,513,626 D493E probably benign Het
Vmn2r77 T A 7: 86,802,039 W378R probably benign Het
Vps13b A T 15: 35,876,419 T2799S probably damaging Het
Vps8 T C 16: 21,608,177 S1337P probably benign Het
Zcchc6 A T 13: 59,799,887 N873K probably benign Het
Zfp235 A T 7: 24,140,437 I94F possibly damaging Het
Zfp3 A G 11: 70,772,540 K442E probably damaging Het
Zfp418 A T 7: 7,182,105 I356F possibly damaging Het
Zfp790 G A 7: 29,825,760 G68S probably benign Het
Other mutations in Efcab5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Efcab5 APN 11 77137036 missense probably benign 0.04
IGL01343:Efcab5 APN 11 77129930 missense probably damaging 1.00
IGL02190:Efcab5 APN 11 77121314 missense probably benign 0.38
IGL02270:Efcab5 APN 11 77104313 missense probably damaging 0.97
IGL02572:Efcab5 APN 11 77137888 nonsense probably null
IGL02653:Efcab5 APN 11 77132022 missense probably damaging 0.99
IGL02818:Efcab5 APN 11 77105348 missense probably damaging 0.99
IGL03068:Efcab5 APN 11 77104101 missense probably benign
IGL03222:Efcab5 APN 11 77137367 missense probably benign 0.40
IGL03226:Efcab5 APN 11 77137675 missense possibly damaging 0.92
IGL03257:Efcab5 APN 11 77188770 missense probably damaging 0.99
PIT4131001:Efcab5 UTSW 11 77137691
PIT4418001:Efcab5 UTSW 11 77132051 missense possibly damaging 0.89
R0276:Efcab5 UTSW 11 77129876 missense probably damaging 1.00
R0276:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0277:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0284:Efcab5 UTSW 11 77103527 intron probably benign
R0386:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0386:Efcab5 UTSW 11 77172378 missense probably benign 0.30
R0966:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0968:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R1433:Efcab5 UTSW 11 77105378 missense probably benign 0.09
R1673:Efcab5 UTSW 11 77151853 missense probably damaging 0.99
R1842:Efcab5 UTSW 11 77134875 missense probably benign 0.00
R1848:Efcab5 UTSW 11 77103306 missense probably damaging 1.00
R2069:Efcab5 UTSW 11 77172321 missense probably benign 0.06
R3713:Efcab5 UTSW 11 77116182 missense probably damaging 1.00
R4012:Efcab5 UTSW 11 77117830 missense probably damaging 0.98
R4020:Efcab5 UTSW 11 77104104 missense probably benign 0.33
R4391:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4392:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4692:Efcab5 UTSW 11 77113681 missense probably damaging 1.00
R4929:Efcab5 UTSW 11 77103383 missense probably benign 0.36
R4985:Efcab5 UTSW 11 77138229 missense probably damaging 0.98
R4988:Efcab5 UTSW 11 77137252 missense probably damaging 1.00
R5246:Efcab5 UTSW 11 77188845 missense probably damaging 1.00
R5260:Efcab5 UTSW 11 77137651 missense possibly damaging 0.92
R5387:Efcab5 UTSW 11 77134842 missense possibly damaging 0.93
R5516:Efcab5 UTSW 11 77188789 missense possibly damaging 0.62
R5535:Efcab5 UTSW 11 77151921 missense probably damaging 1.00
R5694:Efcab5 UTSW 11 77188875 missense probably benign 0.09
R5922:Efcab5 UTSW 11 77188744 missense probably benign 0.44
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6183:Efcab5 UTSW 11 77137258 missense probably benign 0.04
R6437:Efcab5 UTSW 11 77137902 missense probably benign 0.25
R6442:Efcab5 UTSW 11 77105434 nonsense probably null
R6592:Efcab5 UTSW 11 77113610 missense possibly damaging 0.90
R6769:Efcab5 UTSW 11 77105432 missense probably damaging 0.98
R7257:Efcab5 UTSW 11 77137779 missense probably damaging 0.99
R7285:Efcab5 UTSW 11 77137344 missense probably benign
R7285:Efcab5 UTSW 11 77138215 missense possibly damaging 0.49
R7350:Efcab5 UTSW 11 77137561 missense probably benign 0.05
R7369:Efcab5 UTSW 11 77117835 missense possibly damaging 0.60
R7760:Efcab5 UTSW 11 77151926 missense probably benign 0.31
R8213:Efcab5 UTSW 11 77116071 missense probably damaging 1.00
R8690:Efcab5 UTSW 11 77103289 missense probably damaging 0.98
R9294:Efcab5 UTSW 11 77121238 missense probably benign 0.03
R9310:Efcab5 UTSW 11 77113705 missense probably benign 0.23
R9324:Efcab5 UTSW 11 77113720 missense possibly damaging 0.95
R9405:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
R9407:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
X0061:Efcab5 UTSW 11 77116234 missense probably damaging 1.00
Z1176:Efcab5 UTSW 11 77132139 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGTTGTACATTTCTAAAGAGATGGC -3'
(R):5'- ACAATGTGATGGGAGGCATC -3'

Sequencing Primer
(F):5'- TGGCACACTAGGAGGAAGAACC -3'
(R):5'- AACAGGTACCATAGGTTTTCCC -3'
Posted On 2022-05-16