Incidental Mutation 'R9404:Atad5'
ID 711428
Institutional Source Beutler Lab
Gene Symbol Atad5
Ensembl Gene ENSMUSG00000017550
Gene Name ATPase family, AAA domain containing 5
Synonyms LOC237877, C130052G03Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9404 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 79980226-80026620 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80005064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1167 (V1167A)
Ref Sequence ENSEMBL: ENSMUSP00000017694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017694] [ENSMUST00000108239]
AlphaFold Q4QY64
Predicted Effect probably damaging
Transcript: ENSMUST00000017694
AA Change: V1167A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000017694
Gene: ENSMUSG00000017550
AA Change: V1167A

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1111 1347 5.14e-5 SMART
Blast:AAA 1409 1526 1e-31 BLAST
low complexity region 1573 1583 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108239
AA Change: V1164A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550
AA Change: V1164A

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1108 1344 5.14e-5 SMART
Blast:AAA 1406 1523 1e-31 BLAST
low complexity region 1570 1580 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for a gene trap allele exhibit genomic instability, premature death, and a wide spectrum of spontaneous tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 T C 4: 106,615,509 (GRCm39) K314R possibly damaging Het
Armt1 AC A 10: 4,400,848 (GRCm39) probably null Het
Bbs12 T C 3: 37,373,557 (GRCm39) S2P probably damaging Het
Cdh11 A T 8: 103,406,254 (GRCm39) L73Q probably damaging Het
Cdk15 A G 1: 59,328,914 (GRCm39) E274G possibly damaging Het
Col27a1 T C 4: 63,194,178 (GRCm39) V845A possibly damaging Het
Cyp3a11 T C 5: 145,799,258 (GRCm39) T310A probably benign Het
Efcab5 G A 11: 77,022,934 (GRCm39) T593I probably damaging Het
Ewsr1 A G 11: 5,022,940 (GRCm39) M388T unknown Het
Fat2 A G 11: 55,144,348 (GRCm39) probably null Het
Gm8225 T A 17: 26,762,034 (GRCm39) I75N probably damaging Het
Gsap A G 5: 21,474,919 (GRCm39) Y526C probably damaging Het
Hk1 T A 10: 62,131,859 (GRCm39) I203F possibly damaging Het
Insl5 T C 4: 102,875,535 (GRCm39) R72G probably benign Het
Iqcb1 T C 16: 36,671,632 (GRCm39) V321A probably damaging Het
Iqcd A C 5: 120,738,601 (GRCm39) T140P Het
Kcnt2 T A 1: 140,353,107 (GRCm39) I272K probably damaging Het
Klhl25 A C 7: 75,515,153 (GRCm39) I20L probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lrba T C 3: 86,205,224 (GRCm39) V356A probably damaging Het
Mast4 A G 13: 102,887,933 (GRCm39) Y1159H probably damaging Het
Mavs T A 2: 131,083,818 (GRCm39) L105Q probably damaging Het
Megf6 T A 4: 154,348,225 (GRCm39) C902S Het
Mmp17 A G 5: 129,682,741 (GRCm39) D460G possibly damaging Het
Myh2 G T 11: 67,070,454 (GRCm39) A466S probably damaging Het
Neb T C 2: 52,147,788 (GRCm39) N2744D probably damaging Het
Oga CTCGGGTC CTC 19: 45,743,096 (GRCm39) probably null Het
Or13a26 T A 7: 140,284,722 (GRCm39) L186H probably damaging Het
Or2a12 T C 6: 42,904,750 (GRCm39) V195A probably benign Het
Or2aj4 C T 16: 19,384,731 (GRCm39) V301M probably benign Het
Or4a27 T A 2: 88,559,551 (GRCm39) M131L probably benign Het
Or6d13 T G 6: 116,517,708 (GRCm39) I98S probably damaging Het
Or8g55 A T 9: 39,784,708 (GRCm39) I46F possibly damaging Het
Parpbp A G 10: 87,950,411 (GRCm39) V323A possibly damaging Het
Pax5 G A 4: 44,645,565 (GRCm39) P255S possibly damaging Het
Pcdhga2 A G 18: 37,803,067 (GRCm39) T304A probably benign Het
Pcsk1 T G 13: 75,280,342 (GRCm39) S722R probably benign Het
Pcsk9 C A 4: 106,311,723 (GRCm39) R218L probably damaging Het
Pds5a T A 5: 65,776,307 (GRCm39) I96F probably damaging Het
Pkdrej C A 15: 85,703,270 (GRCm39) V889L probably benign Het
Plekhh2 A T 17: 84,878,468 (GRCm39) probably null Het
Pnn A G 12: 59,118,758 (GRCm39) E447G probably damaging Het
Ppp2r3d A G 9: 101,025,840 (GRCm39) L289P probably damaging Het
Ppp6r2 A G 15: 89,152,753 (GRCm39) H298R probably benign Het
Ptpn23 T C 9: 110,216,025 (GRCm39) N1277S Het
Pus10 T A 11: 23,661,202 (GRCm39) F263L possibly damaging Het
Rexo5 A G 7: 119,400,542 (GRCm39) Y109C probably damaging Het
Rnf185 A T 11: 3,382,615 (GRCm39) C23* probably null Het
Runx1 T C 16: 92,485,915 (GRCm39) N140D probably benign Het
Sbf2 T C 7: 110,040,702 (GRCm39) Q375R possibly damaging Het
Scn9a G A 2: 66,357,040 (GRCm39) T1087I probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Sh2b1 TC TCAGCCACGGGGACCAGCCC 7: 126,066,771 (GRCm39) probably benign Het
Slc7a11 T C 3: 50,335,488 (GRCm39) H350R possibly damaging Het
Spaca6 T C 17: 18,057,800 (GRCm39) C155R probably damaging Het
Spire2 C T 8: 124,090,077 (GRCm39) R580* probably null Het
Srgap3 A T 6: 112,706,616 (GRCm39) M851K probably benign Het
Themis A G 10: 28,665,743 (GRCm39) D602G probably benign Het
Tlcd4 T C 3: 121,028,731 (GRCm39) N52S probably benign Het
Trak2 T C 1: 58,960,296 (GRCm39) T236A possibly damaging Het
Trrap T C 5: 144,752,225 (GRCm39) C1709R possibly damaging Het
Ttn A T 2: 76,584,500 (GRCm39) S22203T probably damaging Het
Tut7 A T 13: 59,947,701 (GRCm39) N873K probably benign Het
Ube3a A G 7: 58,936,763 (GRCm39) T701A probably damaging Het
Ufl1 T C 4: 25,275,912 (GRCm39) I164V probably benign Het
Vcpip1 T C 1: 9,817,856 (GRCm39) T176A probably damaging Het
Virma T A 4: 11,513,626 (GRCm39) D493E probably benign Het
Vmn2r77 T A 7: 86,451,247 (GRCm39) W378R probably benign Het
Vps13b A T 15: 35,876,565 (GRCm39) T2799S probably damaging Het
Vps8 T C 16: 21,426,927 (GRCm39) S1337P probably benign Het
Zfp235 A T 7: 23,839,862 (GRCm39) I94F possibly damaging Het
Zfp3 A G 11: 70,663,366 (GRCm39) K442E probably damaging Het
Zfp418 A T 7: 7,185,104 (GRCm39) I356F possibly damaging Het
Zfp790 G A 7: 29,525,185 (GRCm39) G68S probably benign Het
Other mutations in Atad5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Atad5 APN 11 80,023,684 (GRCm39) missense probably benign 0.22
IGL00916:Atad5 APN 11 80,009,826 (GRCm39) missense probably damaging 1.00
IGL01348:Atad5 APN 11 79,986,390 (GRCm39) missense probably benign 0.00
IGL01601:Atad5 APN 11 79,986,343 (GRCm39) missense probably benign 0.45
IGL01916:Atad5 APN 11 80,003,665 (GRCm39) critical splice donor site probably null
IGL02028:Atad5 APN 11 80,024,936 (GRCm39) missense probably benign 0.20
IGL02095:Atad5 APN 11 79,985,533 (GRCm39) missense probably benign 0.24
IGL02142:Atad5 APN 11 79,985,023 (GRCm39) missense probably benign 0.00
IGL02206:Atad5 APN 11 79,985,009 (GRCm39) missense probably damaging 1.00
IGL02385:Atad5 APN 11 79,985,453 (GRCm39) missense probably benign 0.04
IGL02858:Atad5 APN 11 79,980,601 (GRCm39) missense probably damaging 1.00
IGL02962:Atad5 APN 11 79,999,405 (GRCm39) missense possibly damaging 0.86
PIT4362001:Atad5 UTSW 11 80,002,393 (GRCm39) missense probably benign 0.04
R0040:Atad5 UTSW 11 79,988,840 (GRCm39) missense probably benign
R0157:Atad5 UTSW 11 79,980,643 (GRCm39) missense possibly damaging 0.74
R0211:Atad5 UTSW 11 79,986,473 (GRCm39) missense probably benign 0.00
R0211:Atad5 UTSW 11 79,986,473 (GRCm39) missense probably benign 0.00
R0319:Atad5 UTSW 11 80,011,616 (GRCm39) splice site probably benign
R0401:Atad5 UTSW 11 80,011,525 (GRCm39) missense probably benign 0.11
R0426:Atad5 UTSW 11 80,003,658 (GRCm39) missense probably benign 0.14
R0452:Atad5 UTSW 11 79,997,247 (GRCm39) missense probably damaging 0.98
R0496:Atad5 UTSW 11 79,991,182 (GRCm39) missense probably benign 0.08
R1691:Atad5 UTSW 11 79,986,358 (GRCm39) missense probably benign 0.00
R1812:Atad5 UTSW 11 80,023,873 (GRCm39) missense probably damaging 0.98
R2070:Atad5 UTSW 11 79,988,878 (GRCm39) splice site probably null
R2071:Atad5 UTSW 11 79,988,878 (GRCm39) splice site probably null
R2153:Atad5 UTSW 11 79,997,203 (GRCm39) missense probably benign 0.04
R2415:Atad5 UTSW 11 79,985,077 (GRCm39) missense probably damaging 1.00
R3917:Atad5 UTSW 11 79,994,120 (GRCm39) missense probably null 0.97
R4025:Atad5 UTSW 11 80,011,512 (GRCm39) missense probably damaging 1.00
R4464:Atad5 UTSW 11 79,991,137 (GRCm39) splice site probably null
R4561:Atad5 UTSW 11 79,986,715 (GRCm39) missense probably benign 0.01
R4579:Atad5 UTSW 11 79,986,017 (GRCm39) missense probably damaging 1.00
R4844:Atad5 UTSW 11 80,005,137 (GRCm39) splice site probably null
R4853:Atad5 UTSW 11 79,986,098 (GRCm39) missense probably damaging 1.00
R4873:Atad5 UTSW 11 80,011,515 (GRCm39) missense probably damaging 1.00
R4875:Atad5 UTSW 11 80,011,515 (GRCm39) missense probably damaging 1.00
R5054:Atad5 UTSW 11 79,985,502 (GRCm39) missense probably benign 0.10
R5226:Atad5 UTSW 11 79,985,888 (GRCm39) missense probably damaging 0.99
R5397:Atad5 UTSW 11 80,002,319 (GRCm39) missense probably damaging 1.00
R5449:Atad5 UTSW 11 80,014,934 (GRCm39) missense probably damaging 1.00
R5571:Atad5 UTSW 11 80,002,382 (GRCm39) missense probably benign 0.05
R5575:Atad5 UTSW 11 79,991,149 (GRCm39) missense probably benign 0.02
R5857:Atad5 UTSW 11 80,022,155 (GRCm39) missense probably benign 0.06
R5927:Atad5 UTSW 11 80,018,111 (GRCm39) missense probably damaging 1.00
R5928:Atad5 UTSW 11 79,985,003 (GRCm39) missense probably damaging 1.00
R5949:Atad5 UTSW 11 79,986,835 (GRCm39) nonsense probably null
R6102:Atad5 UTSW 11 80,002,398 (GRCm39) critical splice donor site probably null
R6254:Atad5 UTSW 11 80,018,215 (GRCm39) missense probably damaging 0.96
R6562:Atad5 UTSW 11 80,024,032 (GRCm39) missense probably benign 0.26
R6744:Atad5 UTSW 11 80,024,858 (GRCm39) missense probably benign 0.00
R7092:Atad5 UTSW 11 80,011,546 (GRCm39) missense possibly damaging 0.68
R7202:Atad5 UTSW 11 79,980,601 (GRCm39) missense probably damaging 1.00
R7345:Atad5 UTSW 11 79,986,832 (GRCm39) missense probably damaging 1.00
R7352:Atad5 UTSW 11 79,994,169 (GRCm39) critical splice donor site probably null
R7358:Atad5 UTSW 11 80,023,862 (GRCm39) missense probably benign 0.32
R7420:Atad5 UTSW 11 79,986,688 (GRCm39) missense probably benign 0.06
R7453:Atad5 UTSW 11 80,009,969 (GRCm39) critical splice donor site probably null
R7990:Atad5 UTSW 11 80,024,079 (GRCm39) nonsense probably null
R8012:Atad5 UTSW 11 79,985,066 (GRCm39) missense probably damaging 1.00
R8152:Atad5 UTSW 11 79,985,996 (GRCm39) missense possibly damaging 0.59
R8421:Atad5 UTSW 11 79,985,384 (GRCm39) missense probably damaging 0.98
R8842:Atad5 UTSW 11 80,000,910 (GRCm39) missense possibly damaging 0.87
R8918:Atad5 UTSW 11 79,986,473 (GRCm39) missense probably benign 0.02
R8943:Atad5 UTSW 11 79,986,524 (GRCm39) missense possibly damaging 0.86
R8944:Atad5 UTSW 11 79,986,524 (GRCm39) missense possibly damaging 0.86
R9134:Atad5 UTSW 11 80,023,931 (GRCm39) missense probably benign 0.00
R9137:Atad5 UTSW 11 79,986,481 (GRCm39) missense probably damaging 1.00
R9301:Atad5 UTSW 11 79,986,845 (GRCm39) missense probably damaging 1.00
R9372:Atad5 UTSW 11 79,985,094 (GRCm39) missense possibly damaging 0.68
R9443:Atad5 UTSW 11 80,023,388 (GRCm39) missense probably benign 0.01
R9471:Atad5 UTSW 11 80,023,524 (GRCm39) missense possibly damaging 0.65
R9577:Atad5 UTSW 11 80,004,996 (GRCm39) missense probably damaging 1.00
R9656:Atad5 UTSW 11 79,980,542 (GRCm39) start gained probably benign
R9659:Atad5 UTSW 11 79,980,542 (GRCm39) start gained probably benign
R9661:Atad5 UTSW 11 79,980,542 (GRCm39) start gained probably benign
RF003:Atad5 UTSW 11 80,002,386 (GRCm39) missense probably damaging 0.99
X0024:Atad5 UTSW 11 80,023,609 (GRCm39) missense probably benign 0.02
Z1176:Atad5 UTSW 11 79,985,722 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCCACATGCACTCAGTG -3'
(R):5'- GGAACAAAAGTGTGTTTATGTGCAG -3'

Sequencing Primer
(F):5'- CTTGCAATCCTAGCAGTTGGAAAGC -3'
(R):5'- AAGTGTGTTTATGTGCAGAAAAATAG -3'
Posted On 2022-05-16