Incidental Mutation 'R9404:Spaca6'
ID 711441
Institutional Source Beutler Lab
Gene Symbol Spaca6
Ensembl Gene ENSMUSG00000080316
Gene Name sperm acrosome associated 6
Synonyms B230206P06Rik, 4930546H06Rik, Ncrna00085
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9404 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 17827158-17843009 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17837538 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 155 (C155R)
Ref Sequence ENSEMBL: ENSMUSP00000128732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000139969] [ENSMUST00000150302] [ENSMUST00000172097] [ENSMUST00000226899] [ENSMUST00000228490]
AlphaFold E9Q8Q8
Predicted Effect probably damaging
Transcript: ENSMUST00000139969
AA Change: C135R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119658
Gene: ENSMUSG00000080316
AA Change: C135R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG 151 186 1e-17 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000150302
AA Change: C55R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000154301
SMART Domains Protein: ENSMUSP00000117377
Gene: ENSMUSG00000080316

DomainStartEndE-ValueType
Blast:IG 27 78 2e-32 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000172097
AA Change: C155R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128732
Gene: ENSMUSG00000080316
AA Change: C155R

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IG 171 260 2.08e-1 SMART
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226899
AA Change: C64R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000228490
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion that inactivates this gene exhibit impaired fertilization and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 T C 4: 106,758,312 K314R possibly damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Atad5 T C 11: 80,114,238 V1167A probably damaging Het
Bbs12 T C 3: 37,319,408 S2P probably damaging Het
Cdh11 A T 8: 102,679,622 L73Q probably damaging Het
Cdk15 A G 1: 59,289,755 E274G possibly damaging Het
Col27a1 T C 4: 63,275,941 V845A possibly damaging Het
Cyp3a11 T C 5: 145,862,448 T310A probably benign Het
Efcab5 G A 11: 77,132,108 T593I probably damaging Het
Ewsr1 A G 11: 5,072,940 M388T unknown Het
Fat2 A G 11: 55,253,522 probably null Het
Gm8225 T A 17: 26,543,060 I75N probably damaging Het
Gsap A G 5: 21,269,921 Y526C probably damaging Het
Hk1 T A 10: 62,296,080 I203F possibly damaging Het
Insl5 T C 4: 103,018,338 R72G probably benign Het
Iqcb1 T C 16: 36,851,270 V321A probably damaging Het
Iqcd A C 5: 120,600,536 T140P Het
Kcnt2 T A 1: 140,425,369 I272K probably damaging Het
Klhl25 A C 7: 75,865,405 I20L probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lrba T C 3: 86,297,917 V356A probably damaging Het
Mast4 A G 13: 102,751,425 Y1159H probably damaging Het
Mavs T A 2: 131,241,898 L105Q probably damaging Het
Megf6 T A 4: 154,263,768 C902S Het
Mgea5 CTCGGGTC CTC 19: 45,754,657 probably null Het
Mmp17 A G 5: 129,605,677 D460G possibly damaging Het
Myh2 G T 11: 67,179,628 A466S probably damaging Het
Neb T C 2: 52,257,776 N2744D probably damaging Het
Olfr1197 T A 2: 88,729,207 M131L probably benign Het
Olfr169 C T 16: 19,565,981 V301M probably benign Het
Olfr213 T G 6: 116,540,747 I98S probably damaging Het
Olfr446 T C 6: 42,927,816 V195A probably benign Het
Olfr541 T A 7: 140,704,809 L186H probably damaging Het
Olfr972 A T 9: 39,873,412 I46F possibly damaging Het
Parpbp A G 10: 88,114,549 V323A possibly damaging Het
Pax5 G A 4: 44,645,565 P255S possibly damaging Het
Pcdhga2 A G 18: 37,670,014 T304A probably benign Het
Pcsk1 T G 13: 75,132,223 S722R probably benign Het
Pcsk9 C A 4: 106,454,526 R218L probably damaging Het
Pds5a T A 5: 65,618,964 I96F probably damaging Het
Pkdrej C A 15: 85,819,069 V889L probably benign Het
Plekhh2 A T 17: 84,571,040 probably null Het
Pnn A G 12: 59,071,972 E447G probably damaging Het
Ppp2r3a A G 9: 101,148,641 L289P probably damaging Het
Ppp6r2 A G 15: 89,268,550 H298R probably benign Het
Ptpn23 T C 9: 110,386,957 N1277S Het
Pus10 T A 11: 23,711,202 F263L possibly damaging Het
Rexo5 A G 7: 119,801,319 Y109C probably damaging Het
Rnf185 A T 11: 3,432,615 C23* probably null Het
Runx1 T C 16: 92,689,027 N140D probably benign Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Scn9a G A 2: 66,526,696 T1087I probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 TC TCAGCCACGGGGACCAGCCC 7: 126,467,599 probably benign Het
Slc7a11 T C 3: 50,381,039 H350R possibly damaging Het
Spire2 C T 8: 123,363,338 R580* probably null Het
Srgap3 A T 6: 112,729,655 M851K probably benign Het
Themis A G 10: 28,789,747 D602G probably benign Het
Tmem56 T C 3: 121,235,082 N52S probably benign Het
Trak2 T C 1: 58,921,137 T236A possibly damaging Het
Trrap T C 5: 144,815,415 C1709R possibly damaging Het
Ttn A T 2: 76,754,156 S22203T probably damaging Het
Ube3a A G 7: 59,287,015 T701A probably damaging Het
Ufl1 T C 4: 25,275,912 I164V probably benign Het
Vcpip1 T C 1: 9,747,631 T176A probably damaging Het
Virma T A 4: 11,513,626 D493E probably benign Het
Vmn2r77 T A 7: 86,802,039 W378R probably benign Het
Vps13b A T 15: 35,876,419 T2799S probably damaging Het
Vps8 T C 16: 21,608,177 S1337P probably benign Het
Zcchc6 A T 13: 59,799,887 N873K probably benign Het
Zfp235 A T 7: 24,140,437 I94F possibly damaging Het
Zfp3 A G 11: 70,772,540 K442E probably damaging Het
Zfp418 A T 7: 7,182,105 I356F possibly damaging Het
Zfp790 G A 7: 29,825,760 G68S probably benign Het
Other mutations in Spaca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Spaca6 APN 17 17831167 missense probably benign 0.41
IGL02630:Spaca6 APN 17 17831089 missense probably damaging 1.00
IGL03010:Spaca6 APN 17 17838405 missense probably benign 0.01
IGL03352:Spaca6 APN 17 17838139 missense probably damaging 1.00
R0021:Spaca6 UTSW 17 17838236 nonsense probably null
R0964:Spaca6 UTSW 17 17838391 missense possibly damaging 0.46
R1941:Spaca6 UTSW 17 17838402 missense probably benign 0.05
R1941:Spaca6 UTSW 17 17838430 missense probably damaging 0.99
R2197:Spaca6 UTSW 17 17836154 critical splice donor site probably null
R2235:Spaca6 UTSW 17 17838245 critical splice donor site probably null
R4602:Spaca6 UTSW 17 17831125 missense probably damaging 0.99
R4645:Spaca6 UTSW 17 17836045 intron probably benign
R4672:Spaca6 UTSW 17 17836743 nonsense probably null
R5044:Spaca6 UTSW 17 17831196 missense probably benign 0.00
R5212:Spaca6 UTSW 17 17838394 missense probably benign 0.01
R5222:Spaca6 UTSW 17 17838105 missense probably benign 0.02
R5528:Spaca6 UTSW 17 17831082 missense probably benign
R5854:Spaca6 UTSW 17 17831247 nonsense probably null
R6029:Spaca6 UTSW 17 17831196 missense probably benign 0.00
R7041:Spaca6 UTSW 17 17836096 missense probably benign 0.14
R7268:Spaca6 UTSW 17 17832107 missense probably benign 0.09
R8281:Spaca6 UTSW 17 17832059 missense possibly damaging 0.78
R8840:Spaca6 UTSW 17 17831103 missense possibly damaging 0.59
R8926:Spaca6 UTSW 17 17838528 critical splice donor site probably null
R8965:Spaca6 UTSW 17 17838456 missense probably damaging 0.98
Z1177:Spaca6 UTSW 17 17831052 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CACAAGCCAGAAGGTTAGCCAG -3'
(R):5'- GACTCTGGCAACTCGAAAGC -3'

Sequencing Primer
(F):5'- AAGGTTAGCCAGGGCCTTACTG -3'
(R):5'- GCAACTCGAAAGCCACGATACAAG -3'
Posted On 2022-05-16