Incidental Mutation 'R9405:Ddx60'
ID 711464
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R9405 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 61928087-62038244 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 61972214 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 679 (L679M)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
AlphaFold E9PZQ1
Predicted Effect probably benign
Transcript: ENSMUST00000070631
AA Change: L678M

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: L678M

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000093485
AA Change: L679M

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: L679M

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,149,438 Q277L probably damaging Het
Adamts18 A G 8: 113,703,398 V1135A probably damaging Het
Apobr A G 7: 126,585,532 S72G possibly damaging Het
Arl13b T A 16: 62,811,897 Q214L possibly damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Asah2 T G 19: 32,008,645 T542P possibly damaging Het
Asns C T 6: 7,689,283 C73Y probably damaging Het
C130060K24Rik T A 6: 65,456,094 N299K probably benign Het
Calhm2 T A 19: 47,135,669 T79S probably benign Het
Cd300c2 T G 11: 115,000,761 T96P probably damaging Het
Copb1 G A 7: 114,223,223 T757I possibly damaging Het
Csmd3 T A 15: 47,675,791 T1517S Het
Dip2b A G 15: 100,195,876 K1123R probably benign Het
Dnah17 A G 11: 118,118,911 S612P probably benign Het
Dnah5 T A 15: 28,272,160 C1037S probably benign Het
Efcab5 G A 11: 77,132,108 T593I probably damaging Het
Ei24 A T 9: 36,782,841 I244N possibly damaging Het
Epb41l4a C A 18: 33,810,218 probably null Het
Fam83b A G 9: 76,491,421 M800T possibly damaging Het
Fcf1 T G 12: 84,974,239 C98G probably benign Het
Hist1h2bb T C 13: 23,747,158 Y122H probably benign Het
Hltf G T 3: 20,082,930 Q417H possibly damaging Het
Hmg20b T C 10: 81,349,424 S35G probably benign Het
Igkv4-57-1 T G 6: 69,544,541 Y59S probably damaging Het
Irs2 C T 8: 11,005,061 V1124I possibly damaging Het
Kprp A G 3: 92,824,253 C497R unknown Het
Krt15 A T 11: 100,132,135 V418E probably benign Het
Lce1e G A 3: 92,708,005 P12S unknown Het
Lsmem1 T C 12: 40,177,114 D124G probably damaging Het
Morc3 T C 16: 93,845,148 F85S probably damaging Het
Mtnr1b A T 9: 15,863,151 V204E possibly damaging Het
Myo7b C T 18: 31,976,303 A1172T probably benign Het
Nbeal1 T A 1: 60,310,265 I2362N probably damaging Het
Nde1 T G 16: 14,188,391 L261R probably damaging Het
Neurl1b A G 17: 26,439,291 D401G probably benign Het
Nfkb2 T C 19: 46,308,400 V303A probably damaging Het
Nlrc5 C T 8: 94,473,024 P88S probably damaging Het
Olfr1280 T A 2: 111,316,115 I212K possibly damaging Het
Olfr286 T A 15: 98,227,031 I207F possibly damaging Het
Olfr772 T A 10: 129,174,296 M242L probably benign Het
Pde1c T A 6: 56,072,214 K705* probably null Het
Pear1 A T 3: 87,752,583 F699I probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Prickle1 A T 15: 93,502,980 L541* probably null Het
Prss39 G A 1: 34,499,263 G70S probably damaging Het
Prune2 T G 19: 17,216,344 N3065K probably damaging Het
Rdh5 A C 10: 128,918,068 D127E probably benign Het
Ryr3 G A 2: 112,834,267 H1580Y probably damaging Het
Sash1 G A 10: 8,762,230 probably benign Het
Scgb3a2 T A 18: 43,767,064 L139Q possibly damaging Het
Six1 A G 12: 73,046,321 S36P probably damaging Het
Slc30a5 T C 13: 100,813,908 I281V probably benign Het
Snai2 T A 16: 14,706,725 Y32N probably benign Het
Stat2 T C 10: 128,278,765 S244P probably damaging Het
Syne1 A G 10: 5,202,030 I5759T probably damaging Het
Tbc1d23 T C 16: 57,192,622 N329S possibly damaging Het
Tex2 A T 11: 106,544,388 S737R unknown Het
Trav13d-3 G A 14: 53,033,258 R59H probably benign Het
Tspan9 C T 6: 127,967,161 A59T probably benign Het
Usp53 G A 3: 122,953,269 A349V probably damaging Het
Vmn1r188 T C 13: 22,088,728 L284P probably damaging Het
Vmn2r85 T C 10: 130,425,346 N374S probably damaging Het
Zfp622 A T 15: 25,984,949 I134F probably damaging Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 splice site probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
Scatter UTSW 8 62021314 missense possibly damaging 0.80
shotgun UTSW 8 62037067 missense probably benign 0.28
splay UTSW 8 62021309 missense possibly damaging 0.80
G1Funyon:Ddx60 UTSW 8 62000597 missense probably benign 0.01
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 61954535 missense probably benign 0.03
R8124:Ddx60 UTSW 8 61983911 missense probably benign
R8125:Ddx60 UTSW 8 61983911 missense probably benign
R8126:Ddx60 UTSW 8 61983911 missense probably benign
R8155:Ddx60 UTSW 8 62017171 missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62017250 splice site probably null
R8192:Ddx60 UTSW 8 61977968 missense probably damaging 1.00
R8271:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R8301:Ddx60 UTSW 8 62000597 missense probably benign 0.01
R8304:Ddx60 UTSW 8 61998769 missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 61942635 critical splice donor site probably null
R8374:Ddx60 UTSW 8 61974171 missense probably benign 0.01
R8401:Ddx60 UTSW 8 61956243 missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 61974150 missense probably damaging 1.00
R8804:Ddx60 UTSW 8 61958606 missense probably benign 0.27
R8826:Ddx60 UTSW 8 61945956 missense probably benign 0.02
R8829:Ddx60 UTSW 8 61940661 missense probably damaging 1.00
R8881:Ddx60 UTSW 8 62021309 missense possibly damaging 0.80
R8884:Ddx60 UTSW 8 61994519 missense possibly damaging 0.86
R8990:Ddx60 UTSW 8 61974134 nonsense probably null
R9122:Ddx60 UTSW 8 61989864 missense probably benign 0.16
R9225:Ddx60 UTSW 8 62017841 missense probably benign 0.36
R9278:Ddx60 UTSW 8 61977978 missense possibly damaging 0.83
R9293:Ddx60 UTSW 8 62009960 missense possibly damaging 0.89
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62000588 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AACTGTAAGATTCCCATCTAGTCC -3'
(R):5'- GAAAGCTAGCAGTCTTAAGCAG -3'

Sequencing Primer
(F):5'- TGGTGAGTAAGAGAGTAAGTGTCATG -3'
(R):5'- TCCCCAAGAGAAGGTTGGTC -3'
Posted On 2022-05-16