Incidental Mutation 'R9405:Myo7b'
ID 711503
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Name myosin VIIB
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9405 (G1)
Quality Score 215.009
Status Not validated
Chromosome 18
Chromosomal Location 31959234-32036961 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 31976303 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 1172 (A1172T)
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
AlphaFold Q99MZ6
Predicted Effect probably benign
Transcript: ENSMUST00000134663
AA Change: A1172T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388
AA Change: A1172T

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b T A 9: 119,149,438 Q277L probably damaging Het
Adamts18 A G 8: 113,703,398 V1135A probably damaging Het
Apobr A G 7: 126,585,532 S72G possibly damaging Het
Arl13b T A 16: 62,811,897 Q214L possibly damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Asah2 T G 19: 32,008,645 T542P possibly damaging Het
Asns C T 6: 7,689,283 C73Y probably damaging Het
C130060K24Rik T A 6: 65,456,094 N299K probably benign Het
Calhm2 T A 19: 47,135,669 T79S probably benign Het
Cd300c2 T G 11: 115,000,761 T96P probably damaging Het
Copb1 G A 7: 114,223,223 T757I possibly damaging Het
Csmd3 T A 15: 47,675,791 T1517S Het
Ddx60 T A 8: 61,972,214 L679M probably benign Het
Dip2b A G 15: 100,195,876 K1123R probably benign Het
Dnah17 A G 11: 118,118,911 S612P probably benign Het
Dnah5 T A 15: 28,272,160 C1037S probably benign Het
Efcab5 G A 11: 77,132,108 T593I probably damaging Het
Ei24 A T 9: 36,782,841 I244N possibly damaging Het
Epb41l4a C A 18: 33,810,218 probably null Het
Fam83b A G 9: 76,491,421 M800T possibly damaging Het
Fcf1 T G 12: 84,974,239 C98G probably benign Het
Hist1h2bb T C 13: 23,747,158 Y122H probably benign Het
Hltf G T 3: 20,082,930 Q417H possibly damaging Het
Hmg20b T C 10: 81,349,424 S35G probably benign Het
Igkv4-57-1 T G 6: 69,544,541 Y59S probably damaging Het
Irs2 C T 8: 11,005,061 V1124I possibly damaging Het
Kprp A G 3: 92,824,253 C497R unknown Het
Krt15 A T 11: 100,132,135 V418E probably benign Het
Lce1e G A 3: 92,708,005 P12S unknown Het
Lsmem1 T C 12: 40,177,114 D124G probably damaging Het
Morc3 T C 16: 93,845,148 F85S probably damaging Het
Mtnr1b A T 9: 15,863,151 V204E possibly damaging Het
Nbeal1 T A 1: 60,310,265 I2362N probably damaging Het
Nde1 T G 16: 14,188,391 L261R probably damaging Het
Neurl1b A G 17: 26,439,291 D401G probably benign Het
Nfkb2 T C 19: 46,308,400 V303A probably damaging Het
Nlrc5 C T 8: 94,473,024 P88S probably damaging Het
Olfr1280 T A 2: 111,316,115 I212K possibly damaging Het
Olfr286 T A 15: 98,227,031 I207F possibly damaging Het
Olfr772 T A 10: 129,174,296 M242L probably benign Het
Pde1c T A 6: 56,072,214 K705* probably null Het
Pear1 A T 3: 87,752,583 F699I probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Prickle1 A T 15: 93,502,980 L541* probably null Het
Prss39 G A 1: 34,499,263 G70S probably damaging Het
Prune2 T G 19: 17,216,344 N3065K probably damaging Het
Rdh5 A C 10: 128,918,068 D127E probably benign Het
Ryr3 G A 2: 112,834,267 H1580Y probably damaging Het
Sash1 G A 10: 8,762,230 probably benign Het
Scgb3a2 T A 18: 43,767,064 L139Q possibly damaging Het
Six1 A G 12: 73,046,321 S36P probably damaging Het
Slc30a5 T C 13: 100,813,908 I281V probably benign Het
Snai2 T A 16: 14,706,725 Y32N probably benign Het
Stat2 T C 10: 128,278,765 S244P probably damaging Het
Syne1 A G 10: 5,202,030 I5759T probably damaging Het
Tbc1d23 T C 16: 57,192,622 N329S possibly damaging Het
Tex2 A T 11: 106,544,388 S737R unknown Het
Trav13d-3 G A 14: 53,033,258 R59H probably benign Het
Tspan9 C T 6: 127,967,161 A59T probably benign Het
Usp53 G A 3: 122,953,269 A349V probably damaging Het
Vmn1r188 T C 13: 22,088,728 L284P probably damaging Het
Vmn2r85 T C 10: 130,425,346 N374S probably damaging Het
Zfp622 A T 15: 25,984,949 I134F probably damaging Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32021556 utr 5 prime probably benign
IGL01799:Myo7b APN 18 31962770 missense probably damaging 1.00
IGL01881:Myo7b APN 18 32000267 splice site probably benign
IGL01883:Myo7b APN 18 31998151 missense probably damaging 1.00
IGL01934:Myo7b APN 18 32001341 critical splice donor site probably null
IGL01980:Myo7b APN 18 31961900 missense possibly damaging 0.86
IGL02506:Myo7b APN 18 31967154 missense probably damaging 1.00
IGL02704:Myo7b APN 18 31966961 missense probably benign 0.13
IGL02929:Myo7b APN 18 31994925 missense probably benign 0.19
IGL03149:Myo7b APN 18 32014302 missense probably damaging 1.00
IGL03335:Myo7b APN 18 31985020 missense possibly damaging 0.81
IGL03372:Myo7b APN 18 31998601 missense probably damaging 1.00
IGL03385:Myo7b APN 18 31989577 missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 31961206 missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 31959466 missense possibly damaging 0.80
PIT4445001:Myo7b UTSW 18 31962352 missense probably damaging 0.96
R0034:Myo7b UTSW 18 31960860 missense probably damaging 1.00
R0138:Myo7b UTSW 18 32010151 missense probably damaging 1.00
R0149:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0226:Myo7b UTSW 18 31972896 missense probably benign 0.00
R0312:Myo7b UTSW 18 32014337 missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32014209 missense probably damaging 1.00
R0506:Myo7b UTSW 18 31964386 critical splice donor site probably null
R0524:Myo7b UTSW 18 32013424 missense possibly damaging 0.91
R0645:Myo7b UTSW 18 31994909 missense probably benign 0.10
R0724:Myo7b UTSW 18 32005549 splice site probably benign
R0731:Myo7b UTSW 18 31961825 splice site probably null
R0762:Myo7b UTSW 18 31983944 missense probably benign 0.01
R0843:Myo7b UTSW 18 31974084 missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32000070 missense probably damaging 1.00
R0966:Myo7b UTSW 18 31998763 missense probably damaging 1.00
R1205:Myo7b UTSW 18 31994342 missense probably damaging 1.00
R1387:Myo7b UTSW 18 31983752 splice site probably benign
R1523:Myo7b UTSW 18 31966876 missense probably damaging 1.00
R1544:Myo7b UTSW 18 31994909 missense probably benign 0.10
R1623:Myo7b UTSW 18 32000051 missense probably damaging 1.00
R1780:Myo7b UTSW 18 31961185 missense probably damaging 1.00
R1785:Myo7b UTSW 18 31994897 missense probably benign
R1786:Myo7b UTSW 18 31994897 missense probably benign
R1796:Myo7b UTSW 18 31986675 missense possibly damaging 0.93
R1907:Myo7b UTSW 18 31976999 missense possibly damaging 0.89
R2027:Myo7b UTSW 18 31984960 missense probably benign
R2102:Myo7b UTSW 18 31999978 missense probably damaging 1.00
R2174:Myo7b UTSW 18 31983557 missense probably damaging 1.00
R2272:Myo7b UTSW 18 31977043 missense probably benign 0.41
R2323:Myo7b UTSW 18 31971345 missense probably damaging 1.00
R2365:Myo7b UTSW 18 32014331 missense probably damaging 0.98
R3078:Myo7b UTSW 18 31967184 missense probably benign 0.04
R3522:Myo7b UTSW 18 32010079 missense probably damaging 1.00
R3788:Myo7b UTSW 18 31974112 missense possibly damaging 0.95
R3880:Myo7b UTSW 18 31969514 missense probably damaging 0.96
R4334:Myo7b UTSW 18 31976987 missense probably damaging 1.00
R4343:Myo7b UTSW 18 31983627 missense probably damaging 1.00
R4497:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4498:Myo7b UTSW 18 32014229 missense probably benign 0.06
R4551:Myo7b UTSW 18 31985108 missense probably benign 0.01
R4593:Myo7b UTSW 18 32013375 missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32003487 splice site probably null
R4646:Myo7b UTSW 18 31994369 missense probably benign 0.25
R4648:Myo7b UTSW 18 31967125 splice site probably null
R4737:Myo7b UTSW 18 31998602 missense probably damaging 1.00
R4765:Myo7b UTSW 18 31961900 missense probably benign 0.00
R4790:Myo7b UTSW 18 32000105 splice site probably null
R4909:Myo7b UTSW 18 31964436 missense probably benign 0.01
R5027:Myo7b UTSW 18 31975212 missense probably benign 0.22
R5034:Myo7b UTSW 18 31971387 missense probably damaging 1.00
R5112:Myo7b UTSW 18 31983587 missense probably damaging 1.00
R5266:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5267:Myo7b UTSW 18 31998734 missense probably damaging 1.00
R5348:Myo7b UTSW 18 31983919 missense probably damaging 0.96
R5457:Myo7b UTSW 18 31971450 splice site probably null
R5540:Myo7b UTSW 18 32007090 missense probably damaging 1.00
R5628:Myo7b UTSW 18 31974187 missense probably benign
R5815:Myo7b UTSW 18 31966288 missense probably damaging 1.00
R6062:Myo7b UTSW 18 31967990 missense possibly damaging 0.94
R6137:Myo7b UTSW 18 31999974 missense probably damaging 1.00
R6158:Myo7b UTSW 18 31988549 missense probably benign 0.00
R6218:Myo7b UTSW 18 31959454 missense probably benign 0.10
R6256:Myo7b UTSW 18 31983695 missense probably damaging 1.00
R6257:Myo7b UTSW 18 32013415 missense probably damaging 1.00
R6265:Myo7b UTSW 18 31998150 missense probably damaging 1.00
R6302:Myo7b UTSW 18 31994386 missense probably damaging 0.98
R6438:Myo7b UTSW 18 31966329 missense probably damaging 1.00
R6654:Myo7b UTSW 18 31990269 missense possibly damaging 0.46
R7030:Myo7b UTSW 18 31971573 missense probably damaging 1.00
R7090:Myo7b UTSW 18 31998712 missense probably damaging 1.00
R7210:Myo7b UTSW 18 32007102 missense probably damaging 1.00
R7218:Myo7b UTSW 18 31981001 missense probably benign 0.05
R7378:Myo7b UTSW 18 31966239 missense probably damaging 1.00
R7458:Myo7b UTSW 18 31988551 missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32013267 missense probably damaging 0.99
R7559:Myo7b UTSW 18 31983360 missense probably benign 0.01
R7667:Myo7b UTSW 18 31961905 missense probably benign
R7737:Myo7b UTSW 18 32014204 nonsense probably null
R7942:Myo7b UTSW 18 32013369 missense probably damaging 0.98
R8030:Myo7b UTSW 18 31998082 missense probably damaging 0.96
R8114:Myo7b UTSW 18 31965624 missense probably damaging 1.00
R8338:Myo7b UTSW 18 31971355 missense probably damaging 0.96
R8341:Myo7b UTSW 18 31983926 missense probably benign 0.39
R8406:Myo7b UTSW 18 31959813 missense probably damaging 1.00
R8464:Myo7b UTSW 18 31962704 missense probably benign 0.00
R8517:Myo7b UTSW 18 31967191 missense possibly damaging 0.87
R8537:Myo7b UTSW 18 31977089 missense probably benign 0.08
R8546:Myo7b UTSW 18 31990148 missense probably benign 0.19
R8721:Myo7b UTSW 18 32007011 missense probably damaging 1.00
R8770:Myo7b UTSW 18 31981071 missense probably benign 0.03
R8841:Myo7b UTSW 18 31964437 missense probably benign 0.06
R8853:Myo7b UTSW 18 31986691 missense possibly damaging 0.67
R8960:Myo7b UTSW 18 31994246 splice site probably benign
R8984:Myo7b UTSW 18 31966349 missense probably null 0.68
R9356:Myo7b UTSW 18 31977043 missense probably damaging 1.00
R9357:Myo7b UTSW 18 31960076 missense probably damaging 1.00
R9364:Myo7b UTSW 18 32000360 missense probably benign 0.12
R9533:Myo7b UTSW 18 31975244 missense probably benign 0.27
X0027:Myo7b UTSW 18 31965636 missense probably damaging 1.00
Z1176:Myo7b UTSW 18 31980998 missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 31985056 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGACCTGGAAGGATCAAC -3'
(R):5'- AGAGTTAGAGTCTATCTGAGCGTG -3'

Sequencing Primer
(F):5'- GACATGAGTTTAGTACCTGGTACCC -3'
(R):5'- GTCTATCTGAGCGTGACTAGAACC -3'
Posted On 2022-05-16