Incidental Mutation 'R9406:Vps16'
ID 711517
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene Name VSP16 CORVET/HOPS core subunit
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock # R9406 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 130424339-130444269 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 130441505 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000028900] [ENSMUST00000028900] [ENSMUST00000128994]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000028900
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000028900
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000028900
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik A G 17: 35,568,590 Y275C possibly damaging Het
3632451O06Rik C T 14: 49,773,488 G254E possibly damaging Het
4932414N04Rik A G 2: 68,667,675 K150R unknown Het
Aatf ACACACACACACACACACACACACACACACACACACACACACACACAC ACACACACACACACACACACACACACACACACACACACACACACACACAC 11: 84,471,040 probably null Het
Ank3 C A 10: 69,809,181 T92K unknown Het
Cdca2 T C 14: 67,700,323 S294G unknown Het
Cerk A G 15: 86,144,586 I423T possibly damaging Het
Cfap74 A T 4: 155,426,169 K404* probably null Het
Cftr T C 6: 18,299,867 V1213A probably benign Het
Chst11 A G 10: 83,191,047 T103A possibly damaging Het
Col22a1 A G 15: 71,973,692 I407T probably damaging Het
Cpn2 A G 16: 30,259,542 V447A probably benign Het
Crybg3 T C 16: 59,558,476 E805G probably benign Het
Cstb A G 10: 78,427,339 H66R probably benign Het
Cyp2g1 T C 7: 26,819,485 probably null Het
Fkbp1b G T 12: 4,833,732 H88N probably benign Het
Gm4884 A T 7: 41,043,141 D178V probably damaging Het
Grik5 T C 7: 25,058,544 T371A probably benign Het
Hydin G A 8: 110,587,780 G4299S probably null Het
Ibtk A T 9: 85,721,340 Y537* probably null Het
Ighv8-9 A G 12: 115,468,637 L18P probably damaging Het
Lbp G T 2: 158,317,557 K203N probably benign Het
Lilra6 C T 7: 3,914,854 R97Q probably benign Het
Man1c1 A G 4: 134,576,007 I392T probably damaging Het
Mcf2l A T 8: 13,009,676 H727L probably damaging Het
Med7 T A 11: 46,441,038 F153L probably benign Het
Neurl1b G C 17: 26,438,846 V253L probably benign Het
Noc2l T C 4: 156,236,054 S4P probably benign Het
Obscn A C 11: 59,056,979 F4408C Het
Olfr1318 A G 2: 112,156,298 I116V probably benign Het
Olfr346 A G 2: 36,688,284 Y94C possibly damaging Het
Orc2 T C 1: 58,467,683 Q498R probably damaging Het
Oxsm A C 14: 16,242,531 D79E probably benign Het
Pask G A 1: 93,324,265 T464I probably benign Het
Pcdha8 A G 18: 36,993,869 N468S probably damaging Het
Pcm1 T A 8: 41,275,685 V565E probably damaging Het
Pcsk5 T C 19: 17,793,733 I67V probably benign Het
Pde4d A G 13: 109,740,530 D139G probably damaging Het
Pdzd8 C T 19: 59,344,813 E259K Het
Phactr3 T C 2: 178,284,063 L377P probably damaging Het
Ppargc1b G A 18: 61,310,980 P387S possibly damaging Het
Prmt7 T G 8: 106,243,803 V426G probably damaging Het
Rab39 G C 9: 53,686,615 P117A probably damaging Het
Rab40b G A 11: 121,363,526 R62* probably null Het
Rpf1 T G 3: 146,508,182 H220P probably damaging Het
Rps6kl1 A G 12: 85,139,506 I276T probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Sestd1 G A 2: 77,245,077 probably benign Het
Slc38a6 T A 12: 73,329,993 Y140* probably null Het
Smpd1 C A 7: 105,554,543 H4Q possibly damaging Het
Sox8 A T 17: 25,567,660 S356R probably damaging Het
Tapbpl A G 6: 125,228,356 L209P probably damaging Het
Txndc11 A G 16: 11,075,634 L744P probably benign Het
Ush2a C T 1: 188,263,449 P139L probably benign Het
Vmn1r54 A T 6: 90,269,110 N2I probably damaging Het
Vmn2r112 C T 17: 22,605,242 Q493* probably null Het
Zfp40 A T 17: 23,177,155 S153T possibly damaging Het
Zfp523 G A 17: 28,197,866 A109T probably benign Het
Zfp78 A T 7: 6,379,183 N411Y probably benign Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130437696 missense probably benign 0.19
IGL01400:Vps16 APN 2 130438353 missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130438394 missense probably damaging 0.97
IGL02011:Vps16 APN 2 130441479 missense probably benign 0.04
IGL02192:Vps16 APN 2 130440932 missense probably damaging 0.98
IGL02220:Vps16 APN 2 130441653 missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130439716 critical splice donor site probably null
R0427:Vps16 UTSW 2 130438850 missense probably benign 0.00
R0507:Vps16 UTSW 2 130437712 critical splice donor site probably null
R1550:Vps16 UTSW 2 130440340 missense probably benign 0.09
R1789:Vps16 UTSW 2 130443600 missense probably benign 0.42
R3895:Vps16 UTSW 2 130438676 missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130442594 missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130439912 missense probably damaging 1.00
R4555:Vps16 UTSW 2 130443576 missense probably damaging 1.00
R4569:Vps16 UTSW 2 130442204 missense probably benign
R4803:Vps16 UTSW 2 130438110 missense probably benign 0.27
R4835:Vps16 UTSW 2 130438300 splice site probably benign
R5022:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5023:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5057:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5158:Vps16 UTSW 2 130441279 missense probably damaging 1.00
R5177:Vps16 UTSW 2 130443368 nonsense probably null
R5540:Vps16 UTSW 2 130442385 missense probably benign 0.00
R5680:Vps16 UTSW 2 130440324 missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130439091 nonsense probably null
R5690:Vps16 UTSW 2 130439091 nonsense probably null
R5926:Vps16 UTSW 2 130443556 missense probably damaging 0.97
R5992:Vps16 UTSW 2 130424449 critical splice donor site probably null
R6135:Vps16 UTSW 2 130438653 missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130443384 missense probably damaging 1.00
R6898:Vps16 UTSW 2 130437681 missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130438179 missense probably damaging 1.00
R7487:Vps16 UTSW 2 130439057 nonsense probably null
R7641:Vps16 UTSW 2 130440528 missense probably benign 0.28
R7720:Vps16 UTSW 2 130441703 nonsense probably null
R8246:Vps16 UTSW 2 130438873 missense probably damaging 1.00
R8363:Vps16 UTSW 2 130442241 missense probably benign 0.08
R9092:Vps16 UTSW 2 130439673 missense probably damaging 0.99
R9128:Vps16 UTSW 2 130424399 missense possibly damaging 0.51
R9352:Vps16 UTSW 2 130441903 critical splice donor site probably null
R9508:Vps16 UTSW 2 130442441 missense possibly damaging 0.94
R9800:Vps16 UTSW 2 130440485 missense probably benign 0.02
RF021:Vps16 UTSW 2 130438209 missense probably benign 0.09
Z1177:Vps16 UTSW 2 130441426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTCGTGTTACCTTTCCCAG -3'
(R):5'- TGTCGATACAAACTCAGGGCC -3'

Sequencing Primer
(F):5'- TTTCCCAGACACCCCAGGG -3'
(R):5'- TACAAACTCAGGGCCATGGGTTG -3'
Posted On 2022-05-16