Incidental Mutation 'R9406:Lilra6'
ID 711527
Institutional Source Beutler Lab
Gene Symbol Lilra6
Ensembl Gene ENSMUSG00000030427
Gene Name leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
Synonyms Pira3, 7M1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R9406 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 3908280-3915503 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 3914854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 97 (R97Q)
Ref Sequence ENSEMBL: ENSMUSP00000042636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038176] [ENSMUST00000090689] [ENSMUST00000206077]
AlphaFold A0A0B4J1F3
Predicted Effect probably benign
Transcript: ENSMUST00000038176
AA Change: R97Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042636
Gene: ENSMUSG00000030427
AA Change: R97Q

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 40 105 3.11e0 SMART
IG 129 315 4.53e-2 SMART
IG_like 237 302 1.54e-1 SMART
IG_like 328 415 1.79e1 SMART
IG_like 429 517 2.66e1 SMART
IG 529 618 8.59e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090689
AA Change: R97Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000088188
Gene: ENSMUSG00000030427
AA Change: R97Q

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 34 118 7.25e0 SMART
IG_like 129 220 1.62e2 SMART
IG_like 290 377 1.79e1 SMART
IG_like 391 479 2.66e1 SMART
IG 491 580 8.59e-3 SMART
low complexity region 599 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206077
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik A G 17: 35,568,590 Y275C possibly damaging Het
3632451O06Rik C T 14: 49,773,488 G254E possibly damaging Het
4932414N04Rik A G 2: 68,667,675 K150R unknown Het
Aatf ACACACACACACACACACACACACACACACACACACACACACACACAC ACACACACACACACACACACACACACACACACACACACACACACACACAC 11: 84,471,040 probably null Het
Ank3 C A 10: 69,809,181 T92K unknown Het
Cdca2 T C 14: 67,700,323 S294G unknown Het
Cerk A G 15: 86,144,586 I423T possibly damaging Het
Cfap74 A T 4: 155,426,169 K404* probably null Het
Cftr T C 6: 18,299,867 V1213A probably benign Het
Chst11 A G 10: 83,191,047 T103A possibly damaging Het
Col22a1 A G 15: 71,973,692 I407T probably damaging Het
Cpn2 A G 16: 30,259,542 V447A probably benign Het
Crybg3 T C 16: 59,558,476 E805G probably benign Het
Cstb A G 10: 78,427,339 H66R probably benign Het
Cyp2g1 T C 7: 26,819,485 probably null Het
Fkbp1b G T 12: 4,833,732 H88N probably benign Het
Gm4884 A T 7: 41,043,141 D178V probably damaging Het
Grik5 T C 7: 25,058,544 T371A probably benign Het
Hydin G A 8: 110,587,780 G4299S probably null Het
Ibtk A T 9: 85,721,340 Y537* probably null Het
Ighv8-9 A G 12: 115,468,637 L18P probably damaging Het
Lbp G T 2: 158,317,557 K203N probably benign Het
Man1c1 A G 4: 134,576,007 I392T probably damaging Het
Mcf2l A T 8: 13,009,676 H727L probably damaging Het
Med7 T A 11: 46,441,038 F153L probably benign Het
Neurl1b G C 17: 26,438,846 V253L probably benign Het
Noc2l T C 4: 156,236,054 S4P probably benign Het
Obscn A C 11: 59,056,979 F4408C Het
Olfr1318 A G 2: 112,156,298 I116V probably benign Het
Olfr346 A G 2: 36,688,284 Y94C possibly damaging Het
Orc2 T C 1: 58,467,683 Q498R probably damaging Het
Oxsm A C 14: 16,242,531 D79E probably benign Het
Pask G A 1: 93,324,265 T464I probably benign Het
Pcdha8 A G 18: 36,993,869 N468S probably damaging Het
Pcm1 T A 8: 41,275,685 V565E probably damaging Het
Pcsk5 T C 19: 17,793,733 I67V probably benign Het
Pde4d A G 13: 109,740,530 D139G probably damaging Het
Pdzd8 C T 19: 59,344,813 E259K Het
Phactr3 T C 2: 178,284,063 L377P probably damaging Het
Ppargc1b G A 18: 61,310,980 P387S possibly damaging Het
Prmt7 T G 8: 106,243,803 V426G probably damaging Het
Rab39 G C 9: 53,686,615 P117A probably damaging Het
Rab40b G A 11: 121,363,526 R62* probably null Het
Rpf1 T G 3: 146,508,182 H220P probably damaging Het
Rps6kl1 A G 12: 85,139,506 I276T probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Sestd1 G A 2: 77,245,077 probably benign Het
Slc38a6 T A 12: 73,329,993 Y140* probably null Het
Smpd1 C A 7: 105,554,543 H4Q possibly damaging Het
Sox8 A T 17: 25,567,660 S356R probably damaging Het
Tapbpl A G 6: 125,228,356 L209P probably damaging Het
Txndc11 A G 16: 11,075,634 L744P probably benign Het
Ush2a C T 1: 188,263,449 P139L probably benign Het
Vmn1r54 A T 6: 90,269,110 N2I probably damaging Het
Vmn2r112 C T 17: 22,605,242 Q493* probably null Het
Vps16 T C 2: 130,441,505 probably null Het
Zfp40 A T 17: 23,177,155 S153T possibly damaging Het
Zfp523 G A 17: 28,197,866 A109T probably benign Het
Zfp78 A T 7: 6,379,183 N411Y probably benign Het
Other mutations in Lilra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Lilra6 APN 7 3911554 missense probably benign 0.04
IGL00569:Lilra6 APN 7 3914589 missense probably damaging 0.99
IGL00899:Lilra6 APN 7 3913057 missense probably damaging 1.00
IGL00955:Lilra6 APN 7 3911404 splice site probably benign
IGL01585:Lilra6 APN 7 3914499 missense probably benign 0.01
IGL02195:Lilra6 APN 7 3914550 missense probably benign 0.00
IGL02586:Lilra6 APN 7 3908820 missense probably benign 0.36
IGL02719:Lilra6 APN 7 3912992 missense possibly damaging 0.96
IGL03166:Lilra6 APN 7 3912627 missense possibly damaging 0.69
IGL03329:Lilra6 APN 7 3914648 splice site probably benign
R0233:Lilra6 UTSW 7 3914936 missense possibly damaging 0.69
R0233:Lilra6 UTSW 7 3914936 missense possibly damaging 0.69
R0423:Lilra6 UTSW 7 3914775 splice site probably benign
R0483:Lilra6 UTSW 7 3913139 missense probably benign 0.02
R0511:Lilra6 UTSW 7 3912785 missense possibly damaging 0.77
R1472:Lilra6 UTSW 7 3912719 missense probably damaging 1.00
R1560:Lilra6 UTSW 7 3911408 critical splice donor site probably null
R1584:Lilra6 UTSW 7 3912662 missense probably damaging 1.00
R1781:Lilra6 UTSW 7 3915067 missense probably benign 0.28
R2411:Lilra6 UTSW 7 3911454 missense probably damaging 1.00
R2420:Lilra6 UTSW 7 3914858 missense probably damaging 1.00
R4021:Lilra6 UTSW 7 3911418 missense probably benign 0.20
R4074:Lilra6 UTSW 7 3914890 missense probably benign 0.23
R4284:Lilra6 UTSW 7 3908804 missense possibly damaging 0.76
R4508:Lilra6 UTSW 7 3912029 nonsense probably null
R4894:Lilra6 UTSW 7 3912531 missense probably benign 0.01
R4977:Lilra6 UTSW 7 3914383 missense probably benign 0.01
R5048:Lilra6 UTSW 7 3915441 critical splice donor site probably null
R5164:Lilra6 UTSW 7 3914881 missense probably damaging 1.00
R5185:Lilra6 UTSW 7 3914636 missense probably benign 0.00
R5527:Lilra6 UTSW 7 3914587 start gained probably benign
R6281:Lilra6 UTSW 7 3911973 missense probably damaging 1.00
R6480:Lilra6 UTSW 7 3912933 missense probably damaging 1.00
R6512:Lilra6 UTSW 7 3914388 missense probably benign 0.06
R6565:Lilra6 UTSW 7 3915020 missense probably benign
R7017:Lilra6 UTSW 7 3908708 missense possibly damaging 0.93
R7095:Lilra6 UTSW 7 3913197 missense probably damaging 1.00
R7747:Lilra6 UTSW 7 3912996 missense probably benign 0.16
R8056:Lilra6 UTSW 7 3912552 missense probably damaging 1.00
R8280:Lilra6 UTSW 7 3913047 missense probably benign 0.01
R9197:Lilra6 UTSW 7 3912717 missense possibly damaging 0.94
R9354:Lilra6 UTSW 7 3911629 missense probably damaging 1.00
R9379:Lilra6 UTSW 7 3913167 missense probably damaging 1.00
R9462:Lilra6 UTSW 7 3911995 missense probably damaging 0.97
Z1176:Lilra6 UTSW 7 3915074 critical splice acceptor site probably null
Z1177:Lilra6 UTSW 7 3912581 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GAGTCAGTTAAATATCCCCAAGCC -3'
(R):5'- TCCTCAGAGTACAGCCAGAC -3'

Sequencing Primer
(F):5'- AAATATCCCCAAGCCTCATTATTCTC -3'
(R):5'- TCAGAGTACAGCCAGACTCTGTG -3'
Posted On 2022-05-16