Incidental Mutation 'R9406:Cyp2g1'
ID 711530
Institutional Source Beutler Lab
Gene Symbol Cyp2g1
Ensembl Gene ENSMUSG00000049685
Gene Name cytochrome P450, family 2, subfamily g, polypeptide 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9406 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 26808892-26821205 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 26819485 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040944]
AlphaFold Q9WV19
Predicted Effect probably null
Transcript: ENSMUST00000040944
SMART Domains Protein: ENSMUSP00000047150
Gene: ENSMUSG00000049685

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:p450 34 491 4e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik A G 17: 35,568,590 Y275C possibly damaging Het
3632451O06Rik C T 14: 49,773,488 G254E possibly damaging Het
4932414N04Rik A G 2: 68,667,675 K150R unknown Het
Aatf ACACACACACACACACACACACACACACACACACACACACACACACAC ACACACACACACACACACACACACACACACACACACACACACACACACAC 11: 84,471,040 probably null Het
Ank3 C A 10: 69,809,181 T92K unknown Het
Cdca2 T C 14: 67,700,323 S294G unknown Het
Cerk A G 15: 86,144,586 I423T possibly damaging Het
Cfap74 A T 4: 155,426,169 K404* probably null Het
Cftr T C 6: 18,299,867 V1213A probably benign Het
Chst11 A G 10: 83,191,047 T103A possibly damaging Het
Col22a1 A G 15: 71,973,692 I407T probably damaging Het
Cpn2 A G 16: 30,259,542 V447A probably benign Het
Crybg3 T C 16: 59,558,476 E805G probably benign Het
Cstb A G 10: 78,427,339 H66R probably benign Het
Fkbp1b G T 12: 4,833,732 H88N probably benign Het
Gm4884 A T 7: 41,043,141 D178V probably damaging Het
Grik5 T C 7: 25,058,544 T371A probably benign Het
Hydin G A 8: 110,587,780 G4299S probably null Het
Ibtk A T 9: 85,721,340 Y537* probably null Het
Ighv8-9 A G 12: 115,468,637 L18P probably damaging Het
Lbp G T 2: 158,317,557 K203N probably benign Het
Lilra6 C T 7: 3,914,854 R97Q probably benign Het
Man1c1 A G 4: 134,576,007 I392T probably damaging Het
Mcf2l A T 8: 13,009,676 H727L probably damaging Het
Med7 T A 11: 46,441,038 F153L probably benign Het
Neurl1b G C 17: 26,438,846 V253L probably benign Het
Noc2l T C 4: 156,236,054 S4P probably benign Het
Obscn A C 11: 59,056,979 F4408C Het
Olfr1318 A G 2: 112,156,298 I116V probably benign Het
Olfr346 A G 2: 36,688,284 Y94C possibly damaging Het
Orc2 T C 1: 58,467,683 Q498R probably damaging Het
Oxsm A C 14: 16,242,531 D79E probably benign Het
Pask G A 1: 93,324,265 T464I probably benign Het
Pcdha8 A G 18: 36,993,869 N468S probably damaging Het
Pcm1 T A 8: 41,275,685 V565E probably damaging Het
Pcsk5 T C 19: 17,793,733 I67V probably benign Het
Pde4d A G 13: 109,740,530 D139G probably damaging Het
Pdzd8 C T 19: 59,344,813 E259K Het
Phactr3 T C 2: 178,284,063 L377P probably damaging Het
Ppargc1b G A 18: 61,310,980 P387S possibly damaging Het
Prmt7 T G 8: 106,243,803 V426G probably damaging Het
Rab39 G C 9: 53,686,615 P117A probably damaging Het
Rab40b G A 11: 121,363,526 R62* probably null Het
Rpf1 T G 3: 146,508,182 H220P probably damaging Het
Rps6kl1 A G 12: 85,139,506 I276T probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Sestd1 G A 2: 77,245,077 probably benign Het
Slc38a6 T A 12: 73,329,993 Y140* probably null Het
Smpd1 C A 7: 105,554,543 H4Q possibly damaging Het
Sox8 A T 17: 25,567,660 S356R probably damaging Het
Tapbpl A G 6: 125,228,356 L209P probably damaging Het
Txndc11 A G 16: 11,075,634 L744P probably benign Het
Ush2a C T 1: 188,263,449 P139L probably benign Het
Vmn1r54 A T 6: 90,269,110 N2I probably damaging Het
Vmn2r112 C T 17: 22,605,242 Q493* probably null Het
Vps16 T C 2: 130,441,505 probably null Het
Zfp40 A T 17: 23,177,155 S153T possibly damaging Het
Zfp523 G A 17: 28,197,866 A109T probably benign Het
Zfp78 A T 7: 6,379,183 N411Y probably benign Het
Other mutations in Cyp2g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Cyp2g1 APN 7 26809831 missense probably benign 0.05
IGL01137:Cyp2g1 APN 7 26814259 missense possibly damaging 0.87
IGL02052:Cyp2g1 APN 7 26814294 splice site probably benign
IGL02338:Cyp2g1 APN 7 26814804 splice site probably benign
IGL02452:Cyp2g1 APN 7 26811446 missense probably benign 0.28
IGL02523:Cyp2g1 APN 7 26819187 missense probably damaging 1.00
IGL03165:Cyp2g1 APN 7 26809776 missense possibly damaging 0.94
IGL03230:Cyp2g1 APN 7 26819403 missense probably damaging 1.00
PIT4472001:Cyp2g1 UTSW 7 26814194 missense probably benign 0.28
R0106:Cyp2g1 UTSW 7 26814182 missense probably damaging 1.00
R0106:Cyp2g1 UTSW 7 26814182 missense probably damaging 1.00
R0380:Cyp2g1 UTSW 7 26814295 splice site probably benign
R0697:Cyp2g1 UTSW 7 26814727 nonsense probably null
R0830:Cyp2g1 UTSW 7 26814791 missense probably benign 0.00
R1660:Cyp2g1 UTSW 7 26809682 critical splice acceptor site probably null
R2093:Cyp2g1 UTSW 7 26819433 missense probably benign 0.35
R2131:Cyp2g1 UTSW 7 26820710 missense probably damaging 0.99
R4606:Cyp2g1 UTSW 7 26814154 missense possibly damaging 0.80
R5030:Cyp2g1 UTSW 7 26820801 missense probably benign 0.06
R5574:Cyp2g1 UTSW 7 26820740 missense possibly damaging 0.81
R5877:Cyp2g1 UTSW 7 26816640 missense possibly damaging 0.80
R6745:Cyp2g1 UTSW 7 26814179 missense probably damaging 1.00
R7040:Cyp2g1 UTSW 7 26820759 missense probably damaging 0.99
R7223:Cyp2g1 UTSW 7 26814632 missense probably damaging 0.98
R7934:Cyp2g1 UTSW 7 26819193 missense probably damaging 1.00
R8112:Cyp2g1 UTSW 7 26819461 missense probably benign
R8177:Cyp2g1 UTSW 7 26819153 missense probably damaging 1.00
R8194:Cyp2g1 UTSW 7 26814734 missense possibly damaging 0.89
R9043:Cyp2g1 UTSW 7 26809831 missense probably benign 0.05
R9441:Cyp2g1 UTSW 7 26814635 missense possibly damaging 0.72
X0067:Cyp2g1 UTSW 7 26820762 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGTACCCCAGTGTTGTCCTG -3'
(R):5'- AGACAAGGGTCATATGGCTGAC -3'

Sequencing Primer
(F):5'- TATTGCCCAACACAGAACTCTAATAG -3'
(R):5'- AGTCAGGATCTCACGTTAGCC -3'
Posted On 2022-05-16