Mutagenetix > Incidental Mutation

Incidental Mutation 'R9406:Sbf2'

711534

Institutional Source

Beutler Lab

Gene Symbol

Sbf2

Ensembl Gene

ENSMUSG00000038371

Gene Name

SET binding factor 2

Synonyms

mMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2

Accession Numbers

Genbank: NM_177324; MGI: 1921831

Is this an essential gene?

Possibly non essential (E-score: 0.383) question?

Stock #

R9406 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110308013-110614922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110441495 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 375 (Q375R)

Ref Sequence

ENSEMBL: ENSMUSP00000129805 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020] [ENSMUST00000171218]

AlphaFold

E9PXF8

Predicted Effect

probably damaging
Transcript: ENSMUST00000033058
AA Change: Q375R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: Q375R

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	530	752	3.3e-106	PFAM
GRAM	869	955	1.3e-12	SMART
low complexity region	1078	1089	N/A	INTRINSIC
Pfam:Myotub-related	1091	1544	8.3e-86	PFAM
PH	1767	1872	3.05e-18	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000128265
Gene: ENSMUSG00000038371
AA Change: Q25R

Domain	Start	End	E-Value	Type
dDENN	2	74	3.04e-2	SMART
Pfam:SBF2	138	177	1.6e-13	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000164759
AA Change: Q375R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: Q375R

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	420	2e-20	SMART
Pfam:SBF2	528	752	1.6e-107	PFAM
GRAM	869	955	1.3e-12	SMART
Pfam:Myotub-related	1089	1521	1.6e-98	PFAM
PH	1742	1847	3.05e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166020
AA Change: Q329R

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: Q329R

Domain	Start	End	E-Value	Type
uDENN	1	75	9.26e-1	SMART
DENN	70	252	5.68e-75	SMART
dDENN	305	374	2e-20	SMART
Pfam:SBF2	482	706	1.6e-107	PFAM
GRAM	823	909	1.3e-12	SMART
Pfam:Myotub-related	1043	1500	5.9e-98	PFAM
PH	1721	1826	3.05e-18	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000130476
Gene: ENSMUSG00000038371
AA Change: Q191R

Domain	Start	End	E-Value	Type
DENN	2	151	1.96e-37	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171218
AA Change: Q375R

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000129805
Gene: ENSMUSG00000038371
AA Change: Q375R

Domain	Start	End	E-Value	Type
uDENN	1	87	2.27e-33	SMART
DENN	116	298	5.68e-75	SMART
dDENN	351	407	1.5e-1	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	A	G	17: 35,568,590	Y275C	possibly damaging	Het
3632451O06Rik	C	T	14: 49,773,488	G254E	possibly damaging	Het
4932414N04Rik	A	G	2: 68,667,675	K150R	unknown	Het
Aatf	ACACACACACACACACACACACACACACACACACACACACACACACAC	ACACACACACACACACACACACACACACACACACACACACACACACACAC	11: 84,471,040		probably null	Het
Ank3	C	A	10: 69,809,181	T92K	unknown	Het
Cdca2	T	C	14: 67,700,323	S294G	unknown	Het
Cerk	A	G	15: 86,144,586	I423T	possibly damaging	Het
Cfap74	A	T	4: 155,426,169	K404*	probably null	Het
Cftr	T	C	6: 18,299,867	V1213A	probably benign	Het
Chst11	A	G	10: 83,191,047	T103A	possibly damaging	Het
Col22a1	A	G	15: 71,973,692	I407T	probably damaging	Het
Cpn2	A	G	16: 30,259,542	V447A	probably benign	Het
Crybg3	T	C	16: 59,558,476	E805G	probably benign	Het
Cstb	A	G	10: 78,427,339	H66R	probably benign	Het
Cyp2g1	T	C	7: 26,819,485		probably null	Het
Fkbp1b	G	T	12: 4,833,732	H88N	probably benign	Het
Gm4884	A	T	7: 41,043,141	D178V	probably damaging	Het
Grik5	T	C	7: 25,058,544	T371A	probably benign	Het
Hydin	G	A	8: 110,587,780	G4299S	probably null	Het
Ibtk	A	T	9: 85,721,340	Y537*	probably null	Het
Ighv8-9	A	G	12: 115,468,637	L18P	probably damaging	Het
Lbp	G	T	2: 158,317,557	K203N	probably benign	Het
Lilra6	C	T	7: 3,914,854	R97Q	probably benign	Het
Man1c1	A	G	4: 134,576,007	I392T	probably damaging	Het
Mcf2l	A	T	8: 13,009,676	H727L	probably damaging	Het
Med7	T	A	11: 46,441,038	F153L	probably benign	Het
Neurl1b	G	C	17: 26,438,846	V253L	probably benign	Het
Noc2l	T	C	4: 156,236,054	S4P	probably benign	Het
Obscn	A	C	11: 59,056,979	F4408C		Het
Olfr1318	A	G	2: 112,156,298	I116V	probably benign	Het
Olfr346	A	G	2: 36,688,284	Y94C	possibly damaging	Het
Orc2	T	C	1: 58,467,683	Q498R	probably damaging	Het
Oxsm	A	C	14: 16,242,531	D79E	probably benign	Het
Pask	G	A	1: 93,324,265	T464I	probably benign	Het
Pcdha8	A	G	18: 36,993,869	N468S	probably damaging	Het
Pcm1	T	A	8: 41,275,685	V565E	probably damaging	Het
Pcsk5	T	C	19: 17,793,733	I67V	probably benign	Het
Pde4d	A	G	13: 109,740,530	D139G	probably damaging	Het
Pdzd8	C	T	19: 59,344,813	E259K		Het
Phactr3	T	C	2: 178,284,063	L377P	probably damaging	Het
Ppargc1b	G	A	18: 61,310,980	P387S	possibly damaging	Het
Prmt7	T	G	8: 106,243,803	V426G	probably damaging	Het
Rab39	G	C	9: 53,686,615	P117A	probably damaging	Het
Rab40b	G	A	11: 121,363,526	R62*	probably null	Het
Rpf1	T	G	3: 146,508,182	H220P	probably damaging	Het
Rps6kl1	A	G	12: 85,139,506	I276T	probably benign	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,911		probably benign	Het
Sestd1	G	A	2: 77,245,077		probably benign	Het
Slc38a6	T	A	12: 73,329,993	Y140*	probably null	Het
Smpd1	C	A	7: 105,554,543	H4Q	possibly damaging	Het
Sox8	A	T	17: 25,567,660	S356R	probably damaging	Het
Tapbpl	A	G	6: 125,228,356	L209P	probably damaging	Het
Txndc11	A	G	16: 11,075,634	L744P	probably benign	Het
Ush2a	C	T	1: 188,263,449	P139L	probably benign	Het
Vmn1r54	A	T	6: 90,269,110	N2I	probably damaging	Het
Vmn2r112	C	T	17: 22,605,242	Q493*	probably null	Het
Vps16	T	C	2: 130,441,505		probably null	Het
Zfp40	A	T	17: 23,177,155	S153T	possibly damaging	Het
Zfp523	G	A	17: 28,197,866	A109T	probably benign	Het
Zfp78	A	T	7: 6,379,183	N411Y	probably benign	Het

Other mutations in Sbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Sbf2	APN	7	110375832	splice site	probably benign
IGL01089:Sbf2	APN	7	110348962	missense	probably damaging	1.00
IGL01144:Sbf2	APN	7	110329903	missense	probably damaging	1.00
IGL01652:Sbf2	APN	7	110447120	missense	probably damaging	1.00
IGL01950:Sbf2	APN	7	110365825	missense	probably benign	0.00
IGL02027:Sbf2	APN	7	110461141	missense	probably damaging	1.00
IGL02244:Sbf2	APN	7	110560295	missense	probably damaging	1.00
IGL02376:Sbf2	APN	7	110462956	missense	probably damaging	0.99
IGL03405:Sbf2	APN	7	110462932	missense	probably damaging	0.98
N/A - 535:Sbf2	UTSW	7	110312752	missense	probably benign
R0084:Sbf2	UTSW	7	110442366	missense	possibly damaging	0.95
R0092:Sbf2	UTSW	7	110320806	splice site	probably benign
R0121:Sbf2	UTSW	7	110489219	critical splice donor site	probably null
R0464:Sbf2	UTSW	7	110464576	splice site	probably benign
R0505:Sbf2	UTSW	7	110399343	missense	probably damaging	1.00
R0531:Sbf2	UTSW	7	110367323	splice site	probably benign
R0554:Sbf2	UTSW	7	110428287	missense	probably damaging	1.00
R0617:Sbf2	UTSW	7	110330683	frame shift	probably null
R0619:Sbf2	UTSW	7	110310262	missense	possibly damaging	0.87
R0799:Sbf2	UTSW	7	110341355	missense	possibly damaging	0.58
R0898:Sbf2	UTSW	7	110371652	missense	possibly damaging	0.59
R1077:Sbf2	UTSW	7	110367172	splice site	probably benign
R1167:Sbf2	UTSW	7	110364549	missense	probably damaging	1.00
R1169:Sbf2	UTSW	7	110310184	missense	probably benign	0.04
R1424:Sbf2	UTSW	7	110315026	missense	probably damaging	1.00
R1536:Sbf2	UTSW	7	110378043	missense	probably damaging	1.00
R1558:Sbf2	UTSW	7	110428346	missense	probably damaging	1.00
R1601:Sbf2	UTSW	7	110340076	critical splice acceptor site	probably null
R1762:Sbf2	UTSW	7	110312758	missense	probably benign
R1771:Sbf2	UTSW	7	110461146	nonsense	probably null
R1989:Sbf2	UTSW	7	110348923	missense	possibly damaging	0.94
R2109:Sbf2	UTSW	7	110461212	missense	probably damaging	1.00
R2126:Sbf2	UTSW	7	110560295	missense	probably damaging	1.00
R2444:Sbf2	UTSW	7	110330698	missense	probably benign	0.31
R3765:Sbf2	UTSW	7	110375581	missense	probably damaging	1.00
R3808:Sbf2	UTSW	7	110489280	makesense	probably null
R3895:Sbf2	UTSW	7	110447091	missense	probably damaging	0.99
R3978:Sbf2	UTSW	7	110329885	missense	probably benign	0.00
R4056:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4057:Sbf2	UTSW	7	110441466	missense	probably damaging	0.99
R4111:Sbf2	UTSW	7	110428242	missense	probably damaging	1.00
R4569:Sbf2	UTSW	7	110348853	critical splice donor site	probably null
R4670:Sbf2	UTSW	7	110335399	missense	probably damaging	1.00
R4763:Sbf2	UTSW	7	110420917	missense	probably damaging	1.00
R4792:Sbf2	UTSW	7	110351610	missense	probably damaging	0.98
R4811:Sbf2	UTSW	7	110372535	missense	probably damaging	1.00
R4822:Sbf2	UTSW	7	110377939	intron	probably benign
R5110:Sbf2	UTSW	7	110364657	missense	probably benign	0.10
R5143:Sbf2	UTSW	7	110422540	nonsense	probably null
R5443:Sbf2	UTSW	7	110377928	intron	probably benign
R5457:Sbf2	UTSW	7	110312830	missense	probably benign
R5641:Sbf2	UTSW	7	110438901	missense	probably damaging	1.00
R5915:Sbf2	UTSW	7	110378096	nonsense	probably null
R5948:Sbf2	UTSW	7	110489285	missense	probably damaging	1.00
R5977:Sbf2	UTSW	7	110377986	missense	probably benign	0.00
R6052:Sbf2	UTSW	7	110441534	missense	probably damaging	1.00
R6142:Sbf2	UTSW	7	110348975	missense	probably damaging	1.00
R6327:Sbf2	UTSW	7	110441552	missense	probably damaging	1.00
R6356:Sbf2	UTSW	7	110372623	missense	probably damaging	1.00
R6450:Sbf2	UTSW	7	110462863	missense	probably damaging	1.00
R6587:Sbf2	UTSW	7	110440975	missense	probably damaging	1.00
R6696:Sbf2	UTSW	7	110560298	missense	probably benign	0.04
R6986:Sbf2	UTSW	7	110330615	missense	probably damaging	0.99
R7147:Sbf2	UTSW	7	110447061	missense	probably benign	0.01
R7358:Sbf2	UTSW	7	110399348	missense	possibly damaging	0.95
R7414:Sbf2	UTSW	7	110314064	missense	possibly damaging	0.89
R7418:Sbf2	UTSW	7	110365821	missense	probably damaging	1.00
R7423:Sbf2	UTSW	7	110438848	missense	possibly damaging	0.48
R7425:Sbf2	UTSW	7	110375777	nonsense	probably null
R7431:Sbf2	UTSW	7	110351750	missense	probably damaging	1.00
R7497:Sbf2	UTSW	7	110614716	nonsense	probably null
R7556:Sbf2	UTSW	7	110314053	missense	probably benign	0.20
R7604:Sbf2	UTSW	7	110378067	missense	possibly damaging	0.95
R7707:Sbf2	UTSW	7	110330713	critical splice acceptor site	probably null
R7746:Sbf2	UTSW	7	110441426	missense	probably benign	0.01
R7812:Sbf2	UTSW	7	110449963	missense	possibly damaging	0.84
R7849:Sbf2	UTSW	7	110372510	missense	probably damaging	1.00
R8026:Sbf2	UTSW	7	110335387	missense	probably damaging	1.00
R8048:Sbf2	UTSW	7	110315082	missense	probably benign	0.21
R8305:Sbf2	UTSW	7	110371618	missense	possibly damaging	0.79
R8337:Sbf2	UTSW	7	110441462	missense	probably benign
R8773:Sbf2	UTSW	7	110348995	missense	probably benign
R8786:Sbf2	UTSW	7	110464586	critical splice donor site	probably null
R8812:Sbf2	UTSW	7	110329862	missense	probably damaging	1.00
R8876:Sbf2	UTSW	7	110449939	missense	probably damaging	0.99
R8932:Sbf2	UTSW	7	110440948	critical splice donor site	probably null
R8954:Sbf2	UTSW	7	110438911	nonsense	probably null
R8991:Sbf2	UTSW	7	110312689	missense	probably benign	0.20
R9119:Sbf2	UTSW	7	110312085	missense	possibly damaging	0.93
R9310:Sbf2	UTSW	7	110315085	missense	possibly damaging	0.58
R9344:Sbf2	UTSW	7	110341328	missense	probably benign	0.10
R9346:Sbf2	UTSW	7	110320739	missense	probably benign	0.05
R9404:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9408:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9472:Sbf2	UTSW	7	110371591	missense	possibly damaging	0.88
R9554:Sbf2	UTSW	7	110441464	missense	probably damaging	1.00
R9562:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9624:Sbf2	UTSW	7	110364650	missense	probably damaging	1.00
R9652:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9653:Sbf2	UTSW	7	110441495	missense	possibly damaging	0.81
R9709:Sbf2	UTSW	7	110428307	missense	probably damaging	0.99
RF005:Sbf2	UTSW	7	110317008	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCCCAAAAGGACAAGGGG -3'
(R):5'- TATGCCTGTTGCCTGGGAAG -3'

Sequencing Primer
(F):5'- TCTGAAGGAAAATATTACACCAACTC -3'
(R):5'- CTGTTGCCTGGGAAGACGAG -3'

Posted On

2022-05-16