Incidental Mutation 'R9406:Sbf2'
ID 711534
Institutional Source Beutler Lab
Gene Symbol Sbf2
Ensembl Gene ENSMUSG00000038371
Gene Name SET binding factor 2
Synonyms mMTMH1, 4833411B01Rik, Mtmr13, B430219L04Rik, SBF2
Accession Numbers

Genbank: NM_177324; MGI: 1921831

Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock # R9406 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 110308013-110614922 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110441495 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 375 (Q375R)
Ref Sequence ENSEMBL: ENSMUSP00000129805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033058] [ENSMUST00000164759] [ENSMUST00000166020] [ENSMUST00000171218]
AlphaFold E9PXF8
Predicted Effect probably damaging
Transcript: ENSMUST00000033058
AA Change: Q375R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033058
Gene: ENSMUSG00000038371
AA Change: Q375R

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 530 752 3.3e-106 PFAM
GRAM 869 955 1.3e-12 SMART
low complexity region 1078 1089 N/A INTRINSIC
Pfam:Myotub-related 1091 1544 8.3e-86 PFAM
PH 1767 1872 3.05e-18 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000128265
Gene: ENSMUSG00000038371
AA Change: Q25R

DomainStartEndE-ValueType
dDENN 2 74 3.04e-2 SMART
Pfam:SBF2 138 177 1.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164759
AA Change: Q375R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132072
Gene: ENSMUSG00000038371
AA Change: Q375R

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 420 2e-20 SMART
Pfam:SBF2 528 752 1.6e-107 PFAM
GRAM 869 955 1.3e-12 SMART
Pfam:Myotub-related 1089 1521 1.6e-98 PFAM
PH 1742 1847 3.05e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166020
AA Change: Q329R

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126217
Gene: ENSMUSG00000038371
AA Change: Q329R

DomainStartEndE-ValueType
uDENN 1 75 9.26e-1 SMART
DENN 70 252 5.68e-75 SMART
dDENN 305 374 2e-20 SMART
Pfam:SBF2 482 706 1.6e-107 PFAM
GRAM 823 909 1.3e-12 SMART
Pfam:Myotub-related 1043 1500 5.9e-98 PFAM
PH 1721 1826 3.05e-18 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000130476
Gene: ENSMUSG00000038371
AA Change: Q191R

DomainStartEndE-ValueType
DENN 2 151 1.96e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171218
AA Change: Q375R

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129805
Gene: ENSMUSG00000038371
AA Change: Q375R

DomainStartEndE-ValueType
uDENN 1 87 2.27e-33 SMART
DENN 116 298 5.68e-75 SMART
dDENN 351 407 1.5e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pseudophosphatase and member of the myotubularin-related protein family. This gene maps within the CMT4B2 candidate region of chromosome 11p15 and mutations in this gene have been associated with Charcot-Marie-Tooth Disease, type 4B2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null alleles display progressive misfolding of myelin sheaths and abnormal nerve electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik A G 17: 35,568,590 Y275C possibly damaging Het
3632451O06Rik C T 14: 49,773,488 G254E possibly damaging Het
4932414N04Rik A G 2: 68,667,675 K150R unknown Het
Aatf ACACACACACACACACACACACACACACACACACACACACACACACAC ACACACACACACACACACACACACACACACACACACACACACACACACAC 11: 84,471,040 probably null Het
Ank3 C A 10: 69,809,181 T92K unknown Het
Cdca2 T C 14: 67,700,323 S294G unknown Het
Cerk A G 15: 86,144,586 I423T possibly damaging Het
Cfap74 A T 4: 155,426,169 K404* probably null Het
Cftr T C 6: 18,299,867 V1213A probably benign Het
Chst11 A G 10: 83,191,047 T103A possibly damaging Het
Col22a1 A G 15: 71,973,692 I407T probably damaging Het
Cpn2 A G 16: 30,259,542 V447A probably benign Het
Crybg3 T C 16: 59,558,476 E805G probably benign Het
Cstb A G 10: 78,427,339 H66R probably benign Het
Cyp2g1 T C 7: 26,819,485 probably null Het
Fkbp1b G T 12: 4,833,732 H88N probably benign Het
Gm4884 A T 7: 41,043,141 D178V probably damaging Het
Grik5 T C 7: 25,058,544 T371A probably benign Het
Hydin G A 8: 110,587,780 G4299S probably null Het
Ibtk A T 9: 85,721,340 Y537* probably null Het
Ighv8-9 A G 12: 115,468,637 L18P probably damaging Het
Lbp G T 2: 158,317,557 K203N probably benign Het
Lilra6 C T 7: 3,914,854 R97Q probably benign Het
Man1c1 A G 4: 134,576,007 I392T probably damaging Het
Mcf2l A T 8: 13,009,676 H727L probably damaging Het
Med7 T A 11: 46,441,038 F153L probably benign Het
Neurl1b G C 17: 26,438,846 V253L probably benign Het
Noc2l T C 4: 156,236,054 S4P probably benign Het
Obscn A C 11: 59,056,979 F4408C Het
Olfr1318 A G 2: 112,156,298 I116V probably benign Het
Olfr346 A G 2: 36,688,284 Y94C possibly damaging Het
Orc2 T C 1: 58,467,683 Q498R probably damaging Het
Oxsm A C 14: 16,242,531 D79E probably benign Het
Pask G A 1: 93,324,265 T464I probably benign Het
Pcdha8 A G 18: 36,993,869 N468S probably damaging Het
Pcm1 T A 8: 41,275,685 V565E probably damaging Het
Pcsk5 T C 19: 17,793,733 I67V probably benign Het
Pde4d A G 13: 109,740,530 D139G probably damaging Het
Pdzd8 C T 19: 59,344,813 E259K Het
Phactr3 T C 2: 178,284,063 L377P probably damaging Het
Ppargc1b G A 18: 61,310,980 P387S possibly damaging Het
Prmt7 T G 8: 106,243,803 V426G probably damaging Het
Rab39 G C 9: 53,686,615 P117A probably damaging Het
Rab40b G A 11: 121,363,526 R62* probably null Het
Rpf1 T G 3: 146,508,182 H220P probably damaging Het
Rps6kl1 A G 12: 85,139,506 I276T probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Sestd1 G A 2: 77,245,077 probably benign Het
Slc38a6 T A 12: 73,329,993 Y140* probably null Het
Smpd1 C A 7: 105,554,543 H4Q possibly damaging Het
Sox8 A T 17: 25,567,660 S356R probably damaging Het
Tapbpl A G 6: 125,228,356 L209P probably damaging Het
Txndc11 A G 16: 11,075,634 L744P probably benign Het
Ush2a C T 1: 188,263,449 P139L probably benign Het
Vmn1r54 A T 6: 90,269,110 N2I probably damaging Het
Vmn2r112 C T 17: 22,605,242 Q493* probably null Het
Vps16 T C 2: 130,441,505 probably null Het
Zfp40 A T 17: 23,177,155 S153T possibly damaging Het
Zfp523 G A 17: 28,197,866 A109T probably benign Het
Zfp78 A T 7: 6,379,183 N411Y probably benign Het
Other mutations in Sbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sbf2 APN 7 110375832 splice site probably benign
IGL01089:Sbf2 APN 7 110348962 missense probably damaging 1.00
IGL01144:Sbf2 APN 7 110329903 missense probably damaging 1.00
IGL01652:Sbf2 APN 7 110447120 missense probably damaging 1.00
IGL01950:Sbf2 APN 7 110365825 missense probably benign 0.00
IGL02027:Sbf2 APN 7 110461141 missense probably damaging 1.00
IGL02244:Sbf2 APN 7 110560295 missense probably damaging 1.00
IGL02376:Sbf2 APN 7 110462956 missense probably damaging 0.99
IGL03405:Sbf2 APN 7 110462932 missense probably damaging 0.98
N/A - 535:Sbf2 UTSW 7 110312752 missense probably benign
R0084:Sbf2 UTSW 7 110442366 missense possibly damaging 0.95
R0092:Sbf2 UTSW 7 110320806 splice site probably benign
R0121:Sbf2 UTSW 7 110489219 critical splice donor site probably null
R0464:Sbf2 UTSW 7 110464576 splice site probably benign
R0505:Sbf2 UTSW 7 110399343 missense probably damaging 1.00
R0531:Sbf2 UTSW 7 110367323 splice site probably benign
R0554:Sbf2 UTSW 7 110428287 missense probably damaging 1.00
R0617:Sbf2 UTSW 7 110330683 frame shift probably null
R0619:Sbf2 UTSW 7 110310262 missense possibly damaging 0.87
R0799:Sbf2 UTSW 7 110341355 missense possibly damaging 0.58
R0898:Sbf2 UTSW 7 110371652 missense possibly damaging 0.59
R1077:Sbf2 UTSW 7 110367172 splice site probably benign
R1167:Sbf2 UTSW 7 110364549 missense probably damaging 1.00
R1169:Sbf2 UTSW 7 110310184 missense probably benign 0.04
R1424:Sbf2 UTSW 7 110315026 missense probably damaging 1.00
R1536:Sbf2 UTSW 7 110378043 missense probably damaging 1.00
R1558:Sbf2 UTSW 7 110428346 missense probably damaging 1.00
R1601:Sbf2 UTSW 7 110340076 critical splice acceptor site probably null
R1762:Sbf2 UTSW 7 110312758 missense probably benign
R1771:Sbf2 UTSW 7 110461146 nonsense probably null
R1989:Sbf2 UTSW 7 110348923 missense possibly damaging 0.94
R2109:Sbf2 UTSW 7 110461212 missense probably damaging 1.00
R2126:Sbf2 UTSW 7 110560295 missense probably damaging 1.00
R2444:Sbf2 UTSW 7 110330698 missense probably benign 0.31
R3765:Sbf2 UTSW 7 110375581 missense probably damaging 1.00
R3808:Sbf2 UTSW 7 110489280 makesense probably null
R3895:Sbf2 UTSW 7 110447091 missense probably damaging 0.99
R3978:Sbf2 UTSW 7 110329885 missense probably benign 0.00
R4056:Sbf2 UTSW 7 110441466 missense probably damaging 0.99
R4057:Sbf2 UTSW 7 110441466 missense probably damaging 0.99
R4111:Sbf2 UTSW 7 110428242 missense probably damaging 1.00
R4569:Sbf2 UTSW 7 110348853 critical splice donor site probably null
R4670:Sbf2 UTSW 7 110335399 missense probably damaging 1.00
R4763:Sbf2 UTSW 7 110420917 missense probably damaging 1.00
R4792:Sbf2 UTSW 7 110351610 missense probably damaging 0.98
R4811:Sbf2 UTSW 7 110372535 missense probably damaging 1.00
R4822:Sbf2 UTSW 7 110377939 intron probably benign
R5110:Sbf2 UTSW 7 110364657 missense probably benign 0.10
R5143:Sbf2 UTSW 7 110422540 nonsense probably null
R5443:Sbf2 UTSW 7 110377928 intron probably benign
R5457:Sbf2 UTSW 7 110312830 missense probably benign
R5641:Sbf2 UTSW 7 110438901 missense probably damaging 1.00
R5915:Sbf2 UTSW 7 110378096 nonsense probably null
R5948:Sbf2 UTSW 7 110489285 missense probably damaging 1.00
R5977:Sbf2 UTSW 7 110377986 missense probably benign 0.00
R6052:Sbf2 UTSW 7 110441534 missense probably damaging 1.00
R6142:Sbf2 UTSW 7 110348975 missense probably damaging 1.00
R6327:Sbf2 UTSW 7 110441552 missense probably damaging 1.00
R6356:Sbf2 UTSW 7 110372623 missense probably damaging 1.00
R6450:Sbf2 UTSW 7 110462863 missense probably damaging 1.00
R6587:Sbf2 UTSW 7 110440975 missense probably damaging 1.00
R6696:Sbf2 UTSW 7 110560298 missense probably benign 0.04
R6986:Sbf2 UTSW 7 110330615 missense probably damaging 0.99
R7147:Sbf2 UTSW 7 110447061 missense probably benign 0.01
R7358:Sbf2 UTSW 7 110399348 missense possibly damaging 0.95
R7414:Sbf2 UTSW 7 110314064 missense possibly damaging 0.89
R7418:Sbf2 UTSW 7 110365821 missense probably damaging 1.00
R7423:Sbf2 UTSW 7 110438848 missense possibly damaging 0.48
R7425:Sbf2 UTSW 7 110375777 nonsense probably null
R7431:Sbf2 UTSW 7 110351750 missense probably damaging 1.00
R7497:Sbf2 UTSW 7 110614716 nonsense probably null
R7556:Sbf2 UTSW 7 110314053 missense probably benign 0.20
R7604:Sbf2 UTSW 7 110378067 missense possibly damaging 0.95
R7707:Sbf2 UTSW 7 110330713 critical splice acceptor site probably null
R7746:Sbf2 UTSW 7 110441426 missense probably benign 0.01
R7812:Sbf2 UTSW 7 110449963 missense possibly damaging 0.84
R7849:Sbf2 UTSW 7 110372510 missense probably damaging 1.00
R8026:Sbf2 UTSW 7 110335387 missense probably damaging 1.00
R8048:Sbf2 UTSW 7 110315082 missense probably benign 0.21
R8305:Sbf2 UTSW 7 110371618 missense possibly damaging 0.79
R8337:Sbf2 UTSW 7 110441462 missense probably benign
R8773:Sbf2 UTSW 7 110348995 missense probably benign
R8786:Sbf2 UTSW 7 110464586 critical splice donor site probably null
R8812:Sbf2 UTSW 7 110329862 missense probably damaging 1.00
R8876:Sbf2 UTSW 7 110449939 missense probably damaging 0.99
R8932:Sbf2 UTSW 7 110440948 critical splice donor site probably null
R8954:Sbf2 UTSW 7 110438911 nonsense probably null
R8991:Sbf2 UTSW 7 110312689 missense probably benign 0.20
R9119:Sbf2 UTSW 7 110312085 missense possibly damaging 0.93
R9310:Sbf2 UTSW 7 110315085 missense possibly damaging 0.58
R9344:Sbf2 UTSW 7 110341328 missense probably benign 0.10
R9346:Sbf2 UTSW 7 110320739 missense probably benign 0.05
R9404:Sbf2 UTSW 7 110441495 missense possibly damaging 0.81
R9408:Sbf2 UTSW 7 110441495 missense possibly damaging 0.81
R9472:Sbf2 UTSW 7 110371591 missense possibly damaging 0.88
R9554:Sbf2 UTSW 7 110441464 missense probably damaging 1.00
R9562:Sbf2 UTSW 7 110441495 missense possibly damaging 0.81
R9624:Sbf2 UTSW 7 110364650 missense probably damaging 1.00
R9652:Sbf2 UTSW 7 110441495 missense possibly damaging 0.81
R9653:Sbf2 UTSW 7 110441495 missense possibly damaging 0.81
R9709:Sbf2 UTSW 7 110428307 missense probably damaging 0.99
RF005:Sbf2 UTSW 7 110317008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCCAAAAGGACAAGGGG -3'
(R):5'- TATGCCTGTTGCCTGGGAAG -3'

Sequencing Primer
(F):5'- TCTGAAGGAAAATATTACACCAACTC -3'
(R):5'- CTGTTGCCTGGGAAGACGAG -3'
Posted On 2022-05-16