Mutagenetix > Incidental Mutation

Incidental Mutation 'R9406:Col22a1'

711556

Institutional Source

Beutler Lab

Gene Symbol

Col22a1

Ensembl Gene

ENSMUSG00000079022

Gene Name

collagen, type XXII, alpha 1

Synonyms

C80743, 2310067L16Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9406 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

71795795-72034227 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 71973692 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 407 (I407T)

Ref Sequence

ENSEMBL: ENSMUSP00000125069 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159993]

AlphaFold

E9Q7P1

Predicted Effect

probably damaging
Transcript: ENSMUST00000159993
AA Change: I407T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: I407T

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
VWA	45	227	1.35e-51	SMART
TSPN	248	436	1.26e-33	SMART
low complexity region	454	470	N/A	INTRINSIC
internal_repeat_3	494	555	1.96e-13	PROSPERO
internal_repeat_1	496	643	1.49e-19	PROSPERO
low complexity region	644	657	N/A	INTRINSIC
low complexity region	673	707	N/A	INTRINSIC
Pfam:Collagen	751	823	1.5e-9	PFAM
Pfam:Collagen	810	863	2.3e-10	PFAM
Pfam:Collagen	869	931	4.8e-11	PFAM
Pfam:Collagen	926	990	1.1e-10	PFAM
Pfam:Collagen	1031	1087	1.7e-10	PFAM
Pfam:Collagen	1104	1162	1.8e-11	PFAM
low complexity region	1173	1227	N/A	INTRINSIC
low complexity region	1236	1251	N/A	INTRINSIC
internal_repeat_2	1257	1348	3.25e-18	PROSPERO
internal_repeat_4	1268	1347	9.67e-7	PROSPERO
Pfam:Collagen	1389	1448	4e-10	PFAM
Pfam:Collagen	1481	1540	2.6e-9	PFAM
low complexity region	1546	1558	N/A	INTRINSIC
low complexity region	1580	1590	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300002M23Rik	A	G	17: 35,568,590	Y275C	possibly damaging	Het
3632451O06Rik	C	T	14: 49,773,488	G254E	possibly damaging	Het
4932414N04Rik	A	G	2: 68,667,675	K150R	unknown	Het
Aatf	ACACACACACACACACACACACACACACACACACACACACACACACAC	ACACACACACACACACACACACACACACACACACACACACACACACACAC	11: 84,471,040		probably null	Het
Ank3	C	A	10: 69,809,181	T92K	unknown	Het
Cdca2	T	C	14: 67,700,323	S294G	unknown	Het
Cerk	A	G	15: 86,144,586	I423T	possibly damaging	Het
Cfap74	A	T	4: 155,426,169	K404*	probably null	Het
Cftr	T	C	6: 18,299,867	V1213A	probably benign	Het
Chst11	A	G	10: 83,191,047	T103A	possibly damaging	Het
Cpn2	A	G	16: 30,259,542	V447A	probably benign	Het
Crybg3	T	C	16: 59,558,476	E805G	probably benign	Het
Cstb	A	G	10: 78,427,339	H66R	probably benign	Het
Cyp2g1	T	C	7: 26,819,485		probably null	Het
Fkbp1b	G	T	12: 4,833,732	H88N	probably benign	Het
Gm4884	A	T	7: 41,043,141	D178V	probably damaging	Het
Grik5	T	C	7: 25,058,544	T371A	probably benign	Het
Hydin	G	A	8: 110,587,780	G4299S	probably null	Het
Ibtk	A	T	9: 85,721,340	Y537*	probably null	Het
Ighv8-9	A	G	12: 115,468,637	L18P	probably damaging	Het
Lbp	G	T	2: 158,317,557	K203N	probably benign	Het
Lilra6	C	T	7: 3,914,854	R97Q	probably benign	Het
Man1c1	A	G	4: 134,576,007	I392T	probably damaging	Het
Mcf2l	A	T	8: 13,009,676	H727L	probably damaging	Het
Med7	T	A	11: 46,441,038	F153L	probably benign	Het
Neurl1b	G	C	17: 26,438,846	V253L	probably benign	Het
Noc2l	T	C	4: 156,236,054	S4P	probably benign	Het
Obscn	A	C	11: 59,056,979	F4408C		Het
Olfr1318	A	G	2: 112,156,298	I116V	probably benign	Het
Olfr346	A	G	2: 36,688,284	Y94C	possibly damaging	Het
Orc2	T	C	1: 58,467,683	Q498R	probably damaging	Het
Oxsm	A	C	14: 16,242,531	D79E	probably benign	Het
Pask	G	A	1: 93,324,265	T464I	probably benign	Het
Pcdha8	A	G	18: 36,993,869	N468S	probably damaging	Het
Pcm1	T	A	8: 41,275,685	V565E	probably damaging	Het
Pcsk5	T	C	19: 17,793,733	I67V	probably benign	Het
Pde4d	A	G	13: 109,740,530	D139G	probably damaging	Het
Pdzd8	C	T	19: 59,344,813	E259K		Het
Phactr3	T	C	2: 178,284,063	L377P	probably damaging	Het
Ppargc1b	G	A	18: 61,310,980	P387S	possibly damaging	Het
Prmt7	T	G	8: 106,243,803	V426G	probably damaging	Het
Rab39	G	C	9: 53,686,615	P117A	probably damaging	Het
Rab40b	G	A	11: 121,363,526	R62*	probably null	Het
Rpf1	T	G	3: 146,508,182	H220P	probably damaging	Het
Rps6kl1	A	G	12: 85,139,506	I276T	probably benign	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,911		probably benign	Het
Sbf2	T	C	7: 110,441,495	Q375R	possibly damaging	Het
Sestd1	G	A	2: 77,245,077		probably benign	Het
Slc38a6	T	A	12: 73,329,993	Y140*	probably null	Het
Smpd1	C	A	7: 105,554,543	H4Q	possibly damaging	Het
Sox8	A	T	17: 25,567,660	S356R	probably damaging	Het
Tapbpl	A	G	6: 125,228,356	L209P	probably damaging	Het
Txndc11	A	G	16: 11,075,634	L744P	probably benign	Het
Ush2a	C	T	1: 188,263,449	P139L	probably benign	Het
Vmn1r54	A	T	6: 90,269,110	N2I	probably damaging	Het
Vmn2r112	C	T	17: 22,605,242	Q493*	probably null	Het
Vps16	T	C	2: 130,441,505		probably null	Het
Zfp40	A	T	17: 23,177,155	S153T	possibly damaging	Het
Zfp523	G	A	17: 28,197,866	A109T	probably benign	Het
Zfp78	A	T	7: 6,379,183	N411Y	probably benign	Het

Other mutations in Col22a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Col22a1	APN	15	71860958	critical splice donor site	probably null
IGL00434:Col22a1	APN	15	72006675	missense	possibly damaging	0.71
IGL00721:Col22a1	APN	15	71846177	missense	unknown
IGL00902:Col22a1	APN	15	71964659	missense	probably damaging	1.00
IGL01311:Col22a1	APN	15	71973637	splice site	probably benign
IGL01329:Col22a1	APN	15	71907040	missense	probably benign	0.02
IGL01527:Col22a1	APN	15	71907031	missense	probably damaging	0.98
IGL01870:Col22a1	APN	15	71952528	missense	probably benign	0.07
IGL02002:Col22a1	APN	15	71811097	splice site	probably benign
IGL02248:Col22a1	APN	15	71799448	missense	unknown
IGL02322:Col22a1	APN	15	71822653	missense	unknown
IGL02472:Col22a1	APN	15	71827753	splice site	probably benign
IGL02685:Col22a1	APN	15	71801915	missense	unknown
IGL02888:Col22a1	APN	15	71846219	missense	unknown
IGL02971:Col22a1	APN	15	72006738	missense	probably damaging	1.00
IGL03175:Col22a1	APN	15	71969103	missense	possibly damaging	0.81
IGL03240:Col22a1	APN	15	71807928	missense	unknown
R0083:Col22a1	UTSW	15	71890497	missense	possibly damaging	0.70
R0383:Col22a1	UTSW	15	71869004	missense	unknown
R0449:Col22a1	UTSW	15	71962671	critical splice donor site	probably null
R0508:Col22a1	UTSW	15	71933413	missense	unknown
R0944:Col22a1	UTSW	15	71881662	missense	probably benign	0.03
R1289:Col22a1	UTSW	15	71837377	missense	unknown
R1436:Col22a1	UTSW	15	71922957	splice site	probably benign
R1439:Col22a1	UTSW	15	71952377	splice site	probably benign
R1460:Col22a1	UTSW	15	71821931	missense	unknown
R1680:Col22a1	UTSW	15	71799361	missense	unknown
R1715:Col22a1	UTSW	15	72006981	missense	possibly damaging	0.79
R1742:Col22a1	UTSW	15	71801913	missense	unknown
R1745:Col22a1	UTSW	15	72006787	missense	probably damaging	1.00
R1763:Col22a1	UTSW	15	72007176	missense	probably damaging	0.96
R1932:Col22a1	UTSW	15	71870140	missense	unknown
R2125:Col22a1	UTSW	15	71848577	missense	unknown
R2126:Col22a1	UTSW	15	71857253	nonsense	probably null
R2137:Col22a1	UTSW	15	72006948	missense	possibly damaging	0.46
R2860:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2861:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2862:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R3704:Col22a1	UTSW	15	71970307	missense	probably damaging	1.00
R3778:Col22a1	UTSW	15	71973692	missense	probably damaging	1.00
R3940:Col22a1	UTSW	15	71981933	nonsense	probably null
R3950:Col22a1	UTSW	15	71977358	missense	possibly damaging	0.90
R4240:Col22a1	UTSW	15	72007131	missense	probably damaging	1.00
R4531:Col22a1	UTSW	15	72007149	missense	probably damaging	1.00
R4597:Col22a1	UTSW	15	71964662	missense	possibly damaging	0.83
R4604:Col22a1	UTSW	15	71952339	missense	probably benign	0.36
R4654:Col22a1	UTSW	15	71973695	missense	possibly damaging	0.95
R4782:Col22a1	UTSW	15	71801925	missense	unknown
R4847:Col22a1	UTSW	15	71799499	missense	unknown
R4980:Col22a1	UTSW	15	71801943	missense	unknown
R4981:Col22a1	UTSW	15	71861066	missense	unknown
R4996:Col22a1	UTSW	15	72007161	missense	probably damaging	0.99
R5007:Col22a1	UTSW	15	71944422	missense	probably damaging	1.00
R5135:Col22a1	UTSW	15	71799337	missense	unknown
R5197:Col22a1	UTSW	15	72009406	missense	probably damaging	0.96
R5292:Col22a1	UTSW	15	71970336	missense	probably damaging	1.00
R5449:Col22a1	UTSW	15	71821949	missense	unknown
R5480:Col22a1	UTSW	15	71964611	missense	probably damaging	0.98
R5627:Col22a1	UTSW	15	71981918	missense	probably damaging	0.98
R5828:Col22a1	UTSW	15	72009491	missense	probably benign	0.01
R5927:Col22a1	UTSW	15	72006966	missense	probably damaging	1.00
R6006:Col22a1	UTSW	15	71973836	missense	probably damaging	1.00
R6245:Col22a1	UTSW	15	71973816	missense	probably damaging	0.99
R6288:Col22a1	UTSW	15	71894869	critical splice acceptor site	probably null
R6482:Col22a1	UTSW	15	71890489	missense	possibly damaging	0.93
R6497:Col22a1	UTSW	15	71890576	missense	possibly damaging	0.85
R6579:Col22a1	UTSW	15	71881653	missense	probably benign	0.18
R6643:Col22a1	UTSW	15	71822037	splice site	probably null
R6663:Col22a1	UTSW	15	71820059	missense	unknown
R7179:Col22a1	UTSW	15	71933413	missense	unknown
R7215:Col22a1	UTSW	15	71970332	nonsense	probably null
R7216:Col22a1	UTSW	15	71973845	missense	probably damaging	1.00
R7505:Col22a1	UTSW	15	71799399	nonsense	probably null
R7585:Col22a1	UTSW	15	71892205	missense	probably damaging	0.99
R7699:Col22a1	UTSW	15	71973851	missense	probably damaging	1.00
R7788:Col22a1	UTSW	15	71952317	critical splice donor site	probably null
R7921:Col22a1	UTSW	15	71981962	splice site	probably null
R8205:Col22a1	UTSW	15	71861069	missense	unknown
R8769:Col22a1	UTSW	15	72006722	missense	probably benign	0.21
R8780:Col22a1	UTSW	15	72006947	missense	probably damaging	0.99
R8827:Col22a1	UTSW	15	71902816	critical splice donor site	probably null
R8843:Col22a1	UTSW	15	72006654	missense	probably damaging	1.00
R8982:Col22a1	UTSW	15	71973638	critical splice donor site	probably null
R9031:Col22a1	UTSW	15	71881674	nonsense	probably null
R9036:Col22a1	UTSW	15	71890582	missense	probably damaging	1.00
R9084:Col22a1	UTSW	15	71820080	missense	unknown
R9281:Col22a1	UTSW	15	71861071	missense	unknown
R9386:Col22a1	UTSW	15	71981945	missense	probably damaging	1.00
R9577:Col22a1	UTSW	15	71965746	missense	probably damaging	0.99
X0066:Col22a1	UTSW	15	71801879	missense	unknown
X0066:Col22a1	UTSW	15	71846200	missense	unknown
Y5406:Col22a1	UTSW	15	71799515	missense	unknown
Z1177:Col22a1	UTSW	15	71915120	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ATTTGGACTCCAGCATGCTCC -3'
(R):5'- TGCCATGAAGGATGCTGTC -3'

Sequencing Primer
(F):5'- TCTCCTCAGAAAGTCCAGGTGATG -3'
(R):5'- CTGTCCGGGTGGTCTTCC -3'

Posted On

2022-05-16