Incidental Mutation 'R9407:Efcab5'
ID 711604
Institutional Source Beutler Lab
Gene Symbol Efcab5
Ensembl Gene ENSMUSG00000050944
Gene Name EF-hand calcium binding domain 5
Synonyms 4930563A03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R9407 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 77089915-77188968 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 77132108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 593 (T593I)
Ref Sequence ENSEMBL: ENSMUSP00000118152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108400] [ENSMUST00000130901]
AlphaFold A0JP43
Predicted Effect probably damaging
Transcript: ENSMUST00000108400
AA Change: T729I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104037
Gene: ENSMUSG00000050944
AA Change: T729I

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 210 219 N/A INTRINSIC
internal_repeat_1 250 352 2.42e-20 PROSPERO
internal_repeat_1 354 452 2.42e-20 PROSPERO
low complexity region 498 513 N/A INTRINSIC
coiled coil region 749 776 N/A INTRINSIC
GAF 877 1066 1.78e-2 SMART
low complexity region 1235 1245 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130901
AA Change: T593I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118152
Gene: ENSMUSG00000050944
AA Change: T593I

DomainStartEndE-ValueType
low complexity region 74 83 N/A INTRINSIC
internal_repeat_1 114 216 1.89e-19 PROSPERO
internal_repeat_1 218 316 1.89e-19 PROSPERO
low complexity region 362 377 N/A INTRINSIC
coiled coil region 613 640 N/A INTRINSIC
GAF 741 930 1.78e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik T C 14: 63,986,180 Y49C probably damaging Het
Abca6 A T 11: 110,202,384 L1021* probably null Het
Abcc9 A G 6: 142,628,503 S1003P possibly damaging Het
Aldh4a1 A G 4: 139,645,034 I505V probably benign Het
Brwd1 T C 16: 96,002,493 D2159G possibly damaging Het
C1s2 T C 6: 124,625,495 I586V probably benign Het
Ccdc105 T C 10: 78,747,294 T419A probably damaging Het
Cd300e C A 11: 115,055,345 D97Y probably damaging Het
Celsr3 A G 9: 108,846,397 D2877G probably damaging Het
Cep41 T C 6: 30,655,842 N328D probably benign Het
Cldn15 G A 5: 136,974,911 V227M probably damaging Het
Clec10a T G 11: 70,169,329 I98S probably damaging Het
Cpne4 A G 9: 104,872,764 Q89R probably damaging Het
Cryba2 C A 1: 74,892,878 A4S probably benign Het
Csmd2 G A 4: 128,548,820 A3222T Het
Dapk1 C A 13: 60,751,177 Y820* probably null Het
Fam189b C A 3: 89,187,338 A416D possibly damaging Het
Fam196b G A 11: 34,402,072 R38Q probably damaging Het
Gar1 A G 3: 129,826,959 Y160H probably damaging Het
Gm21834 T A 17: 57,741,868 I118L probably benign Het
Gtf2a1l G A 17: 88,694,103 G129D probably damaging Het
Gzmb T A 14: 56,260,255 Y176F probably benign Het
Helz2 T G 2: 181,240,182 K273Q probably benign Het
Ifi207 T A 1: 173,727,668 E816V probably damaging Het
Insr A C 8: 3,185,106 D694E probably benign Het
Ipcef1 A T 10: 6,920,036 C172* probably null Het
Itgal T G 7: 127,322,624 probably null Het
Laptm5 A T 4: 130,928,679 M103L Het
Lypd4 A T 7: 24,866,735 C55S probably null Het
Mccc1 A C 3: 35,976,716 H400Q possibly damaging Het
Myl4 C T 11: 104,584,061 R79W probably damaging Het
Myo18a A G 11: 77,818,770 T569A probably benign Het
Olfr1222 T A 2: 89,125,285 T149S probably benign Het
Olfr305 G C 7: 86,363,986 S117* probably null Het
Olfr994 A G 2: 85,430,716 S38P probably damaging Het
Otof T A 5: 30,380,921 D1153V probably damaging Het
Pcdha12 A T 18: 37,020,561 D111V probably damaging Het
Pomt2 G T 12: 87,110,372 F724L probably damaging Het
Ros1 T A 10: 52,118,395 Y1284F probably damaging Het
Skint6 T C 4: 113,177,027 K301R possibly damaging Het
Slc30a5 T A 13: 100,814,706 R223* probably null Het
Slc35a1 A T 4: 34,675,181 V119E probably damaging Het
Slc6a11 A T 6: 114,243,953 I482F probably damaging Het
Tgm1 A T 14: 55,705,534 C616* probably null Het
Tiam2 T A 17: 3,503,023 I1125N probably damaging Het
Tln2 T C 9: 67,229,450 D1251G probably damaging Het
Tnfaip2 C G 12: 111,445,727 S187R probably benign Het
Ush2a A G 1: 188,911,848 Y4469C probably damaging Het
Vmn1r229 G C 17: 20,814,997 C168S probably damaging Het
Vmn2r53 A G 7: 12,601,197 S179P probably damaging Het
Zfp474 A C 18: 52,638,430 I52L probably benign Het
Other mutations in Efcab5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Efcab5 APN 11 77137036 missense probably benign 0.04
IGL01343:Efcab5 APN 11 77129930 missense probably damaging 1.00
IGL02190:Efcab5 APN 11 77121314 missense probably benign 0.38
IGL02270:Efcab5 APN 11 77104313 missense probably damaging 0.97
IGL02572:Efcab5 APN 11 77137888 nonsense probably null
IGL02653:Efcab5 APN 11 77132022 missense probably damaging 0.99
IGL02818:Efcab5 APN 11 77105348 missense probably damaging 0.99
IGL03068:Efcab5 APN 11 77104101 missense probably benign
IGL03222:Efcab5 APN 11 77137367 missense probably benign 0.40
IGL03226:Efcab5 APN 11 77137675 missense possibly damaging 0.92
IGL03257:Efcab5 APN 11 77188770 missense probably damaging 0.99
PIT4131001:Efcab5 UTSW 11 77137691
PIT4418001:Efcab5 UTSW 11 77132051 missense possibly damaging 0.89
R0276:Efcab5 UTSW 11 77129876 missense probably damaging 1.00
R0276:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0277:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0284:Efcab5 UTSW 11 77103527 intron probably benign
R0386:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0386:Efcab5 UTSW 11 77172378 missense probably benign 0.30
R0966:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R0968:Efcab5 UTSW 11 77140923 missense probably damaging 1.00
R1433:Efcab5 UTSW 11 77105378 missense probably benign 0.09
R1673:Efcab5 UTSW 11 77151853 missense probably damaging 0.99
R1842:Efcab5 UTSW 11 77134875 missense probably benign 0.00
R1848:Efcab5 UTSW 11 77103306 missense probably damaging 1.00
R2069:Efcab5 UTSW 11 77172321 missense probably benign 0.06
R3713:Efcab5 UTSW 11 77116182 missense probably damaging 1.00
R4012:Efcab5 UTSW 11 77117830 missense probably damaging 0.98
R4020:Efcab5 UTSW 11 77104104 missense probably benign 0.33
R4391:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4392:Efcab5 UTSW 11 77090458 missense probably damaging 0.99
R4692:Efcab5 UTSW 11 77113681 missense probably damaging 1.00
R4929:Efcab5 UTSW 11 77103383 missense probably benign 0.36
R4985:Efcab5 UTSW 11 77138229 missense probably damaging 0.98
R4988:Efcab5 UTSW 11 77137252 missense probably damaging 1.00
R5246:Efcab5 UTSW 11 77188845 missense probably damaging 1.00
R5260:Efcab5 UTSW 11 77137651 missense possibly damaging 0.92
R5387:Efcab5 UTSW 11 77134842 missense possibly damaging 0.93
R5516:Efcab5 UTSW 11 77188789 missense possibly damaging 0.62
R5535:Efcab5 UTSW 11 77151921 missense probably damaging 1.00
R5694:Efcab5 UTSW 11 77188875 missense probably benign 0.09
R5922:Efcab5 UTSW 11 77188744 missense probably benign 0.44
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6030:Efcab5 UTSW 11 77121262 missense probably damaging 1.00
R6183:Efcab5 UTSW 11 77137258 missense probably benign 0.04
R6437:Efcab5 UTSW 11 77137902 missense probably benign 0.25
R6442:Efcab5 UTSW 11 77105434 nonsense probably null
R6592:Efcab5 UTSW 11 77113610 missense possibly damaging 0.90
R6769:Efcab5 UTSW 11 77105432 missense probably damaging 0.98
R7257:Efcab5 UTSW 11 77137779 missense probably damaging 0.99
R7285:Efcab5 UTSW 11 77137344 missense probably benign
R7285:Efcab5 UTSW 11 77138215 missense possibly damaging 0.49
R7350:Efcab5 UTSW 11 77137561 missense probably benign 0.05
R7369:Efcab5 UTSW 11 77117835 missense possibly damaging 0.60
R7760:Efcab5 UTSW 11 77151926 missense probably benign 0.31
R8213:Efcab5 UTSW 11 77116071 missense probably damaging 1.00
R8690:Efcab5 UTSW 11 77103289 missense probably damaging 0.98
R9294:Efcab5 UTSW 11 77121238 missense probably benign 0.03
R9310:Efcab5 UTSW 11 77113705 missense probably benign 0.23
R9324:Efcab5 UTSW 11 77113720 missense possibly damaging 0.95
R9404:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
R9405:Efcab5 UTSW 11 77132108 missense probably damaging 0.99
X0061:Efcab5 UTSW 11 77116234 missense probably damaging 1.00
Z1176:Efcab5 UTSW 11 77132139 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGTTGTACATTTCTAAAGAGATGGC -3'
(R):5'- ACAATGTGATGGGAGGCATC -3'

Sequencing Primer
(F):5'- TGGCACACTAGGAGGAAGAACC -3'
(R):5'- AACAGGTACCATAGGTTTTCCC -3'
Posted On 2022-05-16