Incidental Mutation 'R9408:Olfr1249'
ID 711632
Institutional Source Beutler Lab
Gene Symbol Olfr1249
Ensembl Gene ENSMUSG00000075079
Gene Name olfactory receptor 1249
Synonyms MOR231-16P, MOR231-16P, GA_x6K02T2Q125-51072323-51071367, MOR231-25_p, MOR231-17P, Olfr1541-ps1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R9408 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 89628902-89634983 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89630044 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 285 (Y285H)
Ref Sequence ENSEMBL: ENSMUSP00000149072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099769] [ENSMUST00000216124]
AlphaFold L7MU51
Predicted Effect probably damaging
Transcript: ENSMUST00000099769
AA Change: Y285H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097357
Gene: ENSMUSG00000075079
AA Change: Y285H

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 4.9e-47 PFAM
Pfam:7tm_1 39 285 1.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216124
AA Change: Y285H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 G A 6: 128,545,067 T1264I probably damaging Het
Aadac T A 3: 60,039,565 V228E probably benign Het
Abca4 A T 3: 122,137,625 R1436W probably benign Het
Abo A G 2: 26,848,275 L39S probably benign Het
Acnat1 T A 4: 49,447,773 R269S probably benign Het
Adap2 T C 11: 80,155,116 V74A probably damaging Het
Ahctf1 C A 1: 179,776,073 A803S possibly damaging Het
Ak6 A G 13: 100,655,495 S149G probably benign Het
Ank T C 15: 27,591,502 V444A probably damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Atf7 A C 15: 102,553,851 V112G probably damaging Het
Brca2 A G 5: 150,541,517 Y1582C probably damaging Het
Bricd5 G T 17: 24,474,109 probably benign Het
Bsn C A 9: 108,139,453 E120* probably null Het
Cacna1g T G 11: 94,430,224 N1348T probably damaging Het
Ccnc T G 4: 21,746,776 probably null Het
Cd163 A G 6: 124,320,538 D881G probably benign Het
Cep295 G A 9: 15,333,323 P1279L probably benign Het
Cic G A 7: 25,271,989 V382I possibly damaging Het
Cyp21a1 G A 17: 34,801,886 S453F probably damaging Het
D16Ertd472e A T 16: 78,547,758 I154N probably benign Het
Dbf4 A G 5: 8,397,764 V482A possibly damaging Het
Dchs2 G A 3: 83,285,266 V1673M probably benign Het
Dctd T A 8: 48,137,350 C119S probably damaging Het
Dock1 A G 7: 135,115,336 T1234A probably damaging Het
Eya4 A T 10: 23,123,907 M386K Het
Fbxw19 T A 9: 109,486,033 M154L probably benign Het
Frmpd1 T A 4: 45,279,182 S636T probably benign Het
Glb1l A T 1: 75,201,039 Y412N probably damaging Het
Gm11639 T A 11: 104,730,429 probably null Het
Gm9833 T A 3: 10,089,347 M392K probably benign Het
Gnb5 T A 9: 75,311,414 L7Q probably damaging Het
Gpr19 C T 6: 134,887,741 V3M unknown Het
Hivep2 A G 10: 14,131,761 T1368A probably damaging Het
Hmx3 A T 7: 131,544,373 Q270L probably damaging Het
Il1rap A T 16: 26,714,925 I524F possibly damaging Het
Mettl17 G A 14: 51,888,034 G198D probably damaging Het
Mga T A 2: 119,935,518 I1421N possibly damaging Het
Myb T A 10: 21,150,376 Q231L probably benign Het
Myf5 G A 10: 107,485,666 T89I probably damaging Het
Nup214 T A 2: 32,047,511 L1999Q probably damaging Het
Olfr1152 G A 2: 87,868,035 G15R probably damaging Het
Olfr1352 A G 10: 78,984,386 M199V probably benign Het
Olfr1378 T A 11: 50,969,786 L256Q probably damaging Het
Olfr432 T C 1: 174,050,763 L130P Het
Olfr574 A T 7: 102,949,236 H257L probably damaging Het
Otog A T 7: 46,267,297 D886V possibly damaging Het
Pde7a A C 3: 19,233,794 V237G possibly damaging Het
Pigs T C 11: 78,339,387 Y327H probably damaging Het
Pkd2l2 T C 18: 34,430,330 V478A probably damaging Het
Pnrc1 C A 4: 33,246,488 G157V probably damaging Het
Poglut1 G T 16: 38,526,775 S343R probably benign Het
Ppwd1 A G 13: 104,209,647 M500T possibly damaging Het
Pyy C T 11: 102,107,285 G23E probably damaging Het
Ripor3 T A 2: 167,989,318 D521V probably benign Het
Rnpepl1 T C 1: 92,917,702 S448P probably benign Het
Sash1 G A 10: 8,762,230 probably benign Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Synj1 C T 16: 90,944,852 C1252Y probably benign Het
Tenm2 A T 11: 36,069,419 L1027Q probably damaging Het
Tep1 A G 14: 50,837,180 V1796A possibly damaging Het
Timp3 A T 10: 86,300,918 E22V possibly damaging Het
Tlk1 A C 2: 70,786,875 probably null Het
Tmco1 C A 1: 167,314,131 T69K Het
Topaz1 T A 9: 122,797,663 M1452K probably benign Het
Tsc22d2 T C 3: 58,460,032 Y668H unknown Het
Uri1 A T 7: 37,969,606 D153E probably benign Het
Vmn1r169 A T 7: 23,577,917 T245S probably damaging Het
Vmn1r60 A G 7: 5,544,919 Y61H Het
Zfp541 A T 7: 16,072,214 E91D probably damaging Het
Zfp946 A G 17: 22,454,588 N108D possibly damaging Het
Zpr1 T C 9: 46,275,449 L194P probably damaging Het
Zzef1 T A 11: 72,864,827 N1027K possibly damaging Het
Other mutations in Olfr1249
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Olfr1249 APN 2 89630620 nonsense probably null
IGL02127:Olfr1249 APN 2 89630754 missense probably damaging 0.97
IGL02555:Olfr1249 APN 2 89630203 missense probably damaging 0.99
IGL02645:Olfr1249 APN 2 89630335 missense probably benign 0.05
IGL03112:Olfr1249 APN 2 89630334 missense probably benign 0.11
BB008:Olfr1249 UTSW 2 89630104 missense possibly damaging 0.78
BB018:Olfr1249 UTSW 2 89630104 missense possibly damaging 0.78
R1460:Olfr1249 UTSW 2 89629938 splice site probably null
R1496:Olfr1249 UTSW 2 89630014 missense possibly damaging 0.96
R4634:Olfr1249 UTSW 2 89630172 missense possibly damaging 0.93
R4635:Olfr1249 UTSW 2 89630172 missense possibly damaging 0.93
R4636:Olfr1249 UTSW 2 89630172 missense possibly damaging 0.93
R5668:Olfr1249 UTSW 2 89630344 missense probably damaging 1.00
R5787:Olfr1249 UTSW 2 89630674 missense probably benign 0.05
R5888:Olfr1249 UTSW 2 89630799 missense probably damaging 0.99
R6267:Olfr1249 UTSW 2 89630631 missense probably damaging 0.98
R6296:Olfr1249 UTSW 2 89630631 missense probably damaging 0.98
R7324:Olfr1249 UTSW 2 89630103 missense possibly damaging 0.78
R7421:Olfr1249 UTSW 2 89630571 missense probably damaging 0.98
R7459:Olfr1249 UTSW 2 89630668 missense probably damaging 1.00
R7931:Olfr1249 UTSW 2 89630104 missense possibly damaging 0.78
R8129:Olfr1249 UTSW 2 89630448 missense probably damaging 1.00
R8239:Olfr1249 UTSW 2 89630563 missense probably damaging 0.97
R9053:Olfr1249 UTSW 2 89630817 missense probably benign 0.01
R9339:Olfr1249 UTSW 2 89630211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGTAGTATGAATGTTCAAGCTGG -3'
(R):5'- TCTATCATTGGCAATAATGGGGC -3'

Sequencing Primer
(F):5'- GAATGTTCAAGCTGGAACTCAC -3'
(R):5'- GCAATGTGCATAGTCATCTTCAC -3'
Posted On 2022-05-16