Incidental Mutation 'R9408:Cep295'
ID 711661
Institutional Source Beutler Lab
Gene Symbol Cep295
Ensembl Gene ENSMUSG00000046111
Gene Name centrosomal protein 295
Synonyms LOC382128, 5830418K08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock # R9408 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 15316915-15357788 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 15333323 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 1279 (P1279L)
Ref Sequence ENSEMBL: ENSMUSP00000123788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000098979
AA Change: P1279L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: P1279L

DomainStartEndE-ValueType
low complexity region 159 175 N/A INTRINSIC
coiled coil region 258 288 N/A INTRINSIC
coiled coil region 536 583 N/A INTRINSIC
coiled coil region 861 889 N/A INTRINSIC
internal_repeat_1 890 1104 6.8e-5 PROSPERO
internal_repeat_1 1277 1489 6.8e-5 PROSPERO
low complexity region 1537 1548 N/A INTRINSIC
low complexity region 1611 1625 N/A INTRINSIC
coiled coil region 1707 1736 N/A INTRINSIC
low complexity region 2003 2018 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000125494
Gene: ENSMUSG00000046111
AA Change: P23L

DomainStartEndE-ValueType
coiled coil region 92 119 N/A INTRINSIC
low complexity region 282 293 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
coiled coil region 451 480 N/A INTRINSIC
low complexity region 828 843 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161132
AA Change: P1279L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: P1279L

DomainStartEndE-ValueType
low complexity region 111 127 N/A INTRINSIC
coiled coil region 210 240 N/A INTRINSIC
coiled coil region 488 535 N/A INTRINSIC
coiled coil region 813 841 N/A INTRINSIC
coiled coil region 1300 1327 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1563 1577 N/A INTRINSIC
coiled coil region 1659 1688 N/A INTRINSIC
low complexity region 2035 2050 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162264
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 G A 6: 128,545,067 T1264I probably damaging Het
Aadac T A 3: 60,039,565 V228E probably benign Het
Abca4 A T 3: 122,137,625 R1436W probably benign Het
Abo A G 2: 26,848,275 L39S probably benign Het
Acnat1 T A 4: 49,447,773 R269S probably benign Het
Adap2 T C 11: 80,155,116 V74A probably damaging Het
Ahctf1 C A 1: 179,776,073 A803S possibly damaging Het
Ak6 A G 13: 100,655,495 S149G probably benign Het
Ank T C 15: 27,591,502 V444A probably damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Atf7 A C 15: 102,553,851 V112G probably damaging Het
Brca2 A G 5: 150,541,517 Y1582C probably damaging Het
Bricd5 G T 17: 24,474,109 probably benign Het
Bsn C A 9: 108,139,453 E120* probably null Het
Cacna1g T G 11: 94,430,224 N1348T probably damaging Het
Ccnc T G 4: 21,746,776 probably null Het
Cd163 A G 6: 124,320,538 D881G probably benign Het
Cic G A 7: 25,271,989 V382I possibly damaging Het
Cyp21a1 G A 17: 34,801,886 S453F probably damaging Het
D16Ertd472e A T 16: 78,547,758 I154N probably benign Het
Dbf4 A G 5: 8,397,764 V482A possibly damaging Het
Dchs2 G A 3: 83,285,266 V1673M probably benign Het
Dctd T A 8: 48,137,350 C119S probably damaging Het
Dock1 A G 7: 135,115,336 T1234A probably damaging Het
Eya4 A T 10: 23,123,907 M386K Het
Fbxw19 T A 9: 109,486,033 M154L probably benign Het
Frmpd1 T A 4: 45,279,182 S636T probably benign Het
Glb1l A T 1: 75,201,039 Y412N probably damaging Het
Gm11639 T A 11: 104,730,429 probably null Het
Gm9833 T A 3: 10,089,347 M392K probably benign Het
Gnb5 T A 9: 75,311,414 L7Q probably damaging Het
Gpr19 C T 6: 134,887,741 V3M unknown Het
Hivep2 A G 10: 14,131,761 T1368A probably damaging Het
Hmx3 A T 7: 131,544,373 Q270L probably damaging Het
Il1rap A T 16: 26,714,925 I524F possibly damaging Het
Mettl17 G A 14: 51,888,034 G198D probably damaging Het
Mga T A 2: 119,935,518 I1421N possibly damaging Het
Myb T A 10: 21,150,376 Q231L probably benign Het
Myf5 G A 10: 107,485,666 T89I probably damaging Het
Nup214 T A 2: 32,047,511 L1999Q probably damaging Het
Olfr1152 G A 2: 87,868,035 G15R probably damaging Het
Olfr1249 A G 2: 89,630,044 Y285H probably damaging Het
Olfr1352 A G 10: 78,984,386 M199V probably benign Het
Olfr1378 T A 11: 50,969,786 L256Q probably damaging Het
Olfr432 T C 1: 174,050,763 L130P Het
Olfr574 A T 7: 102,949,236 H257L probably damaging Het
Otog A T 7: 46,267,297 D886V possibly damaging Het
Pde7a A C 3: 19,233,794 V237G possibly damaging Het
Pigs T C 11: 78,339,387 Y327H probably damaging Het
Pkd2l2 T C 18: 34,430,330 V478A probably damaging Het
Pnrc1 C A 4: 33,246,488 G157V probably damaging Het
Poglut1 G T 16: 38,526,775 S343R probably benign Het
Ppwd1 A G 13: 104,209,647 M500T possibly damaging Het
Pyy C T 11: 102,107,285 G23E probably damaging Het
Ripor3 T A 2: 167,989,318 D521V probably benign Het
Rnpepl1 T C 1: 92,917,702 S448P probably benign Het
Sash1 G A 10: 8,762,230 probably benign Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Synj1 C T 16: 90,944,852 C1252Y probably benign Het
Tenm2 A T 11: 36,069,419 L1027Q probably damaging Het
Tep1 A G 14: 50,837,180 V1796A possibly damaging Het
Timp3 A T 10: 86,300,918 E22V possibly damaging Het
Tlk1 A C 2: 70,786,875 probably null Het
Tmco1 C A 1: 167,314,131 T69K Het
Topaz1 T A 9: 122,797,663 M1452K probably benign Het
Tsc22d2 T C 3: 58,460,032 Y668H unknown Het
Uri1 A T 7: 37,969,606 D153E probably benign Het
Vmn1r169 A T 7: 23,577,917 T245S probably damaging Het
Vmn1r60 A G 7: 5,544,919 Y61H Het
Zfp541 A T 7: 16,072,214 E91D probably damaging Het
Zfp946 A G 17: 22,454,588 N108D possibly damaging Het
Zpr1 T C 9: 46,275,449 L194P probably damaging Het
Zzef1 T A 11: 72,864,827 N1027K possibly damaging Het
Other mutations in Cep295
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Cep295 APN 9 15326072 splice site probably null
IGL00769:Cep295 APN 9 15326144 missense probably damaging 1.00
IGL00771:Cep295 APN 9 15322565 missense probably damaging 1.00
IGL00850:Cep295 APN 9 15322852 missense probably benign 0.36
IGL01505:Cep295 APN 9 15318049 missense probably benign 0.08
IGL01510:Cep295 APN 9 15354626 nonsense probably null
IGL01759:Cep295 APN 9 15323559 splice site probably null
IGL02415:Cep295 APN 9 15353020 missense probably damaging 1.00
IGL02447:Cep295 APN 9 15332511 missense probably damaging 0.98
IGL02502:Cep295 APN 9 15350913 splice site probably benign
IGL02665:Cep295 APN 9 15326632 splice site probably benign
IGL02718:Cep295 APN 9 15325753 splice site probably null
IGL02995:Cep295 APN 9 15333312 missense probably damaging 1.00
IGL03024:Cep295 APN 9 15325572 missense probably benign
R0196:Cep295 UTSW 9 15338213 missense probably damaging 0.96
R0398:Cep295 UTSW 9 15354736 missense possibly damaging 0.90
R0595:Cep295 UTSW 9 15332191 nonsense probably null
R0610:Cep295 UTSW 9 15322754 missense possibly damaging 0.81
R0616:Cep295 UTSW 9 15332322 nonsense probably null
R0840:Cep295 UTSW 9 15334315 missense probably benign 0.02
R1215:Cep295 UTSW 9 15327882 missense probably benign 0.00
R1376:Cep295 UTSW 9 15340868 splice site probably benign
R1381:Cep295 UTSW 9 15322565 missense probably benign 0.02
R1484:Cep295 UTSW 9 15334784 missense probably damaging 0.99
R1557:Cep295 UTSW 9 15332010 nonsense probably null
R1655:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1682:Cep295 UTSW 9 15333921 missense probably benign 0.02
R1700:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1734:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1736:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1743:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1765:Cep295 UTSW 9 15327904 missense probably damaging 1.00
R1889:Cep295 UTSW 9 15332103 missense possibly damaging 0.94
R1895:Cep295 UTSW 9 15332103 missense possibly damaging 0.94
R1994:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R1995:Cep295 UTSW 9 15340883 missense probably damaging 0.99
R2071:Cep295 UTSW 9 15341564 missense probably damaging 1.00
R2161:Cep295 UTSW 9 15353058 missense probably damaging 0.99
R2195:Cep295 UTSW 9 15332321 missense probably damaging 0.99
R2354:Cep295 UTSW 9 15334784 missense possibly damaging 0.92
R2427:Cep295 UTSW 9 15334238 missense probably damaging 1.00
R2992:Cep295 UTSW 9 15332747 missense probably damaging 1.00
R3873:Cep295 UTSW 9 15333365 missense probably damaging 1.00
R3981:Cep295 UTSW 9 15317067 utr 3 prime probably benign
R4201:Cep295 UTSW 9 15332538 missense probably benign 0.19
R4297:Cep295 UTSW 9 15322654 missense probably benign 0.19
R4543:Cep295 UTSW 9 15335253 missense possibly damaging 0.94
R4584:Cep295 UTSW 9 15334799 missense possibly damaging 0.96
R4724:Cep295 UTSW 9 15330832 missense probably damaging 1.00
R4878:Cep295 UTSW 9 15334956 missense probably benign 0.11
R4884:Cep295 UTSW 9 15351760 missense probably damaging 1.00
R4934:Cep295 UTSW 9 15333160 missense probably damaging 0.97
R4990:Cep295 UTSW 9 15332138 missense probably damaging 1.00
R5057:Cep295 UTSW 9 15322683 missense probably benign 0.00
R5153:Cep295 UTSW 9 15357629 missense probably benign 0.32
R5180:Cep295 UTSW 9 15332120 missense probably benign
R5285:Cep295 UTSW 9 15322591 missense probably benign 0.14
R5360:Cep295 UTSW 9 15326733 missense probably damaging 1.00
R5419:Cep295 UTSW 9 15324237 missense probably damaging 0.98
R5432:Cep295 UTSW 9 15351695 missense possibly damaging 0.95
R5625:Cep295 UTSW 9 15340891 missense probably damaging 0.99
R5637:Cep295 UTSW 9 15333812 splice site probably null
R5645:Cep295 UTSW 9 15332794 missense probably damaging 0.98
R5645:Cep295 UTSW 9 15335108 missense possibly damaging 0.89
R5678:Cep295 UTSW 9 15322858 missense probably damaging 0.99
R5688:Cep295 UTSW 9 15331986 missense probably damaging 1.00
R5807:Cep295 UTSW 9 15332532 missense probably damaging 1.00
R5824:Cep295 UTSW 9 15325656 missense possibly damaging 0.90
R5837:Cep295 UTSW 9 15346984 missense probably damaging 0.99
R5915:Cep295 UTSW 9 15341479 missense probably damaging 1.00
R5988:Cep295 UTSW 9 15341474 missense probably damaging 1.00
R6239:Cep295 UTSW 9 15322631 missense possibly damaging 0.46
R6332:Cep295 UTSW 9 15334914 missense possibly damaging 0.90
R6383:Cep295 UTSW 9 15332754 missense probably damaging 0.99
R6737:Cep295 UTSW 9 15332351 missense possibly damaging 0.90
R6929:Cep295 UTSW 9 15333062 missense probably damaging 1.00
R7428:Cep295 UTSW 9 15333498 missense possibly damaging 0.61
R7697:Cep295 UTSW 9 15354710 missense probably benign 0.01
R7963:Cep295 UTSW 9 15333441 missense possibly damaging 0.90
R8055:Cep295 UTSW 9 15333609 missense probably benign 0.00
R8069:Cep295 UTSW 9 15322586 missense possibly damaging 0.94
R8092:Cep295 UTSW 9 15332982 missense probably benign 0.17
R8117:Cep295 UTSW 9 15334364 missense probably damaging 0.99
R8140:Cep295 UTSW 9 15341533 missense probably benign 0.00
R8178:Cep295 UTSW 9 15333540 missense
R8323:Cep295 UTSW 9 15338233 missense possibly damaging 0.53
R8323:Cep295 UTSW 9 15353061 missense probably damaging 0.96
R8339:Cep295 UTSW 9 15325550 missense
R8351:Cep295 UTSW 9 15322906 missense probably damaging 0.99
R8367:Cep295 UTSW 9 15334530 missense probably benign 0.09
R8725:Cep295 UTSW 9 15332419 nonsense probably null
R8919:Cep295 UTSW 9 15326711 missense probably damaging 1.00
R9015:Cep295 UTSW 9 15332968 missense probably benign 0.00
R9054:Cep295 UTSW 9 15324255 missense possibly damaging 0.92
R9088:Cep295 UTSW 9 15322519 missense probably benign 0.09
R9159:Cep295 UTSW 9 15341608 missense probably benign 0.05
R9243:Cep295 UTSW 9 15332309 missense probably benign 0.36
R9424:Cep295 UTSW 9 15333203 missense probably damaging 0.98
R9455:Cep295 UTSW 9 15333750 missense possibly damaging 0.90
X0065:Cep295 UTSW 9 15322891 missense probably benign 0.36
Z1176:Cep295 UTSW 9 15357697 missense probably damaging 0.99
Z1177:Cep295 UTSW 9 15330817 missense
Predicted Primers PCR Primer
(F):5'- GCTGCAGTTCTGGTATCTGAAG -3'
(R):5'- TCAACAGACTGATGCCTTGTC -3'

Sequencing Primer
(F):5'- ATCTGAAGATGGCTTGACTTGAC -3'
(R):5'- AACATCCCGGGGGTCTGTATC -3'
Posted On 2022-05-16