Mutagenetix > Incidental Mutation

Incidental Mutation 'R9408:Cep295'

711661

Institutional Source

Beutler Lab

Gene Symbol

Cep295

Ensembl Gene

ENSMUSG00000046111

Gene Name

centrosomal protein 295

Synonyms

LOC382128, 5830418K08Rik

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.941) question?

Stock #

R9408 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

15316915-15357788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 15333323 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 1279 (P1279L)

Ref Sequence

ENSEMBL: ENSMUSP00000123788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000098979
AA Change: P1279L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: P1279L

Domain	Start	End	E-Value	Type
low complexity region	159	175	N/A	INTRINSIC
coiled coil region	258	288	N/A	INTRINSIC
coiled coil region	536	583	N/A	INTRINSIC
coiled coil region	861	889	N/A	INTRINSIC
internal_repeat_1	890	1104	6.8e-5	PROSPERO
internal_repeat_1	1277	1489	6.8e-5	PROSPERO
low complexity region	1537	1548	N/A	INTRINSIC
low complexity region	1611	1625	N/A	INTRINSIC
coiled coil region	1707	1736	N/A	INTRINSIC
low complexity region	2003	2018	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000125494
Gene: ENSMUSG00000046111
AA Change: P23L

Domain	Start	End	E-Value	Type
coiled coil region	92	119	N/A	INTRINSIC
low complexity region	282	293	N/A	INTRINSIC
low complexity region	356	370	N/A	INTRINSIC
coiled coil region	451	480	N/A	INTRINSIC
low complexity region	828	843	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161132
AA Change: P1279L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: P1279L

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
coiled coil region	1300	1327	N/A	INTRINSIC
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	2035	2050	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162264

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	G	A	6: 128,545,067	T1264I	probably damaging	Het
Aadac	T	A	3: 60,039,565	V228E	probably benign	Het
Abca4	A	T	3: 122,137,625	R1436W	probably benign	Het
Abo	A	G	2: 26,848,275	L39S	probably benign	Het
Acnat1	T	A	4: 49,447,773	R269S	probably benign	Het
Adap2	T	C	11: 80,155,116	V74A	probably damaging	Het
Ahctf1	C	A	1: 179,776,073	A803S	possibly damaging	Het
Ak6	A	G	13: 100,655,495	S149G	probably benign	Het
Ank	T	C	15: 27,591,502	V444A	probably damaging	Het
Armt1	AC	A	10: 4,450,848		probably null	Het
Atf7	A	C	15: 102,553,851	V112G	probably damaging	Het
Brca2	A	G	5: 150,541,517	Y1582C	probably damaging	Het
Bricd5	G	T	17: 24,474,109		probably benign	Het
Bsn	C	A	9: 108,139,453	E120*	probably null	Het
Cacna1g	T	G	11: 94,430,224	N1348T	probably damaging	Het
Ccnc	T	G	4: 21,746,776		probably null	Het
Cd163	A	G	6: 124,320,538	D881G	probably benign	Het
Cic	G	A	7: 25,271,989	V382I	possibly damaging	Het
Cyp21a1	G	A	17: 34,801,886	S453F	probably damaging	Het
D16Ertd472e	A	T	16: 78,547,758	I154N	probably benign	Het
Dbf4	A	G	5: 8,397,764	V482A	possibly damaging	Het
Dchs2	G	A	3: 83,285,266	V1673M	probably benign	Het
Dctd	T	A	8: 48,137,350	C119S	probably damaging	Het
Dock1	A	G	7: 135,115,336	T1234A	probably damaging	Het
Eya4	A	T	10: 23,123,907	M386K		Het
Fbxw19	T	A	9: 109,486,033	M154L	probably benign	Het
Frmpd1	T	A	4: 45,279,182	S636T	probably benign	Het
Glb1l	A	T	1: 75,201,039	Y412N	probably damaging	Het
Gm11639	T	A	11: 104,730,429		probably null	Het
Gm9833	T	A	3: 10,089,347	M392K	probably benign	Het
Gnb5	T	A	9: 75,311,414	L7Q	probably damaging	Het
Gpr19	C	T	6: 134,887,741	V3M	unknown	Het
Hivep2	A	G	10: 14,131,761	T1368A	probably damaging	Het
Hmx3	A	T	7: 131,544,373	Q270L	probably damaging	Het
Il1rap	A	T	16: 26,714,925	I524F	possibly damaging	Het
Mettl17	G	A	14: 51,888,034	G198D	probably damaging	Het
Mga	T	A	2: 119,935,518	I1421N	possibly damaging	Het
Myb	T	A	10: 21,150,376	Q231L	probably benign	Het
Myf5	G	A	10: 107,485,666	T89I	probably damaging	Het
Nup214	T	A	2: 32,047,511	L1999Q	probably damaging	Het
Olfr1152	G	A	2: 87,868,035	G15R	probably damaging	Het
Olfr1249	A	G	2: 89,630,044	Y285H	probably damaging	Het
Olfr1352	A	G	10: 78,984,386	M199V	probably benign	Het
Olfr1378	T	A	11: 50,969,786	L256Q	probably damaging	Het
Olfr432	T	C	1: 174,050,763	L130P		Het
Olfr574	A	T	7: 102,949,236	H257L	probably damaging	Het
Otog	A	T	7: 46,267,297	D886V	possibly damaging	Het
Pde7a	A	C	3: 19,233,794	V237G	possibly damaging	Het
Pigs	T	C	11: 78,339,387	Y327H	probably damaging	Het
Pkd2l2	T	C	18: 34,430,330	V478A	probably damaging	Het
Pnrc1	C	A	4: 33,246,488	G157V	probably damaging	Het
Poglut1	G	T	16: 38,526,775	S343R	probably benign	Het
Ppwd1	A	G	13: 104,209,647	M500T	possibly damaging	Het
Pyy	C	T	11: 102,107,285	G23E	probably damaging	Het
Ripor3	T	A	2: 167,989,318	D521V	probably benign	Het
Rnpepl1	T	C	1: 92,917,702	S448P	probably benign	Het
Sash1	G	A	10: 8,762,230		probably benign	Het
Sbf2	T	C	7: 110,441,495	Q375R	possibly damaging	Het
Synj1	C	T	16: 90,944,852	C1252Y	probably benign	Het
Tenm2	A	T	11: 36,069,419	L1027Q	probably damaging	Het
Tep1	A	G	14: 50,837,180	V1796A	possibly damaging	Het
Timp3	A	T	10: 86,300,918	E22V	possibly damaging	Het
Tlk1	A	C	2: 70,786,875		probably null	Het
Tmco1	C	A	1: 167,314,131	T69K		Het
Topaz1	T	A	9: 122,797,663	M1452K	probably benign	Het
Tsc22d2	T	C	3: 58,460,032	Y668H	unknown	Het
Uri1	A	T	7: 37,969,606	D153E	probably benign	Het
Vmn1r169	A	T	7: 23,577,917	T245S	probably damaging	Het
Vmn1r60	A	G	7: 5,544,919	Y61H		Het
Zfp541	A	T	7: 16,072,214	E91D	probably damaging	Het
Zfp946	A	G	17: 22,454,588	N108D	possibly damaging	Het
Zpr1	T	C	9: 46,275,449	L194P	probably damaging	Het
Zzef1	T	A	11: 72,864,827	N1027K	possibly damaging	Het

Other mutations in Cep295

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Cep295	APN	9	15326072	splice site	probably null
IGL00769:Cep295	APN	9	15326144	missense	probably damaging	1.00
IGL00771:Cep295	APN	9	15322565	missense	probably damaging	1.00
IGL00850:Cep295	APN	9	15322852	missense	probably benign	0.36
IGL01505:Cep295	APN	9	15318049	missense	probably benign	0.08
IGL01510:Cep295	APN	9	15354626	nonsense	probably null
IGL01759:Cep295	APN	9	15323559	splice site	probably null
IGL02415:Cep295	APN	9	15353020	missense	probably damaging	1.00
IGL02447:Cep295	APN	9	15332511	missense	probably damaging	0.98
IGL02502:Cep295	APN	9	15350913	splice site	probably benign
IGL02665:Cep295	APN	9	15326632	splice site	probably benign
IGL02718:Cep295	APN	9	15325753	splice site	probably null
IGL02995:Cep295	APN	9	15333312	missense	probably damaging	1.00
IGL03024:Cep295	APN	9	15325572	missense	probably benign
R0196:Cep295	UTSW	9	15338213	missense	probably damaging	0.96
R0398:Cep295	UTSW	9	15354736	missense	possibly damaging	0.90
R0595:Cep295	UTSW	9	15332191	nonsense	probably null
R0610:Cep295	UTSW	9	15322754	missense	possibly damaging	0.81
R0616:Cep295	UTSW	9	15332322	nonsense	probably null
R0840:Cep295	UTSW	9	15334315	missense	probably benign	0.02
R1215:Cep295	UTSW	9	15327882	missense	probably benign	0.00
R1376:Cep295	UTSW	9	15340868	splice site	probably benign
R1381:Cep295	UTSW	9	15322565	missense	probably benign	0.02
R1484:Cep295	UTSW	9	15334784	missense	probably damaging	0.99
R1557:Cep295	UTSW	9	15332010	nonsense	probably null
R1655:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1682:Cep295	UTSW	9	15333921	missense	probably benign	0.02
R1700:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1734:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1736:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1743:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1765:Cep295	UTSW	9	15327904	missense	probably damaging	1.00
R1889:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1895:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1994:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1995:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R2071:Cep295	UTSW	9	15341564	missense	probably damaging	1.00
R2161:Cep295	UTSW	9	15353058	missense	probably damaging	0.99
R2195:Cep295	UTSW	9	15332321	missense	probably damaging	0.99
R2354:Cep295	UTSW	9	15334784	missense	possibly damaging	0.92
R2427:Cep295	UTSW	9	15334238	missense	probably damaging	1.00
R2992:Cep295	UTSW	9	15332747	missense	probably damaging	1.00
R3873:Cep295	UTSW	9	15333365	missense	probably damaging	1.00
R3981:Cep295	UTSW	9	15317067	utr 3 prime	probably benign
R4201:Cep295	UTSW	9	15332538	missense	probably benign	0.19
R4297:Cep295	UTSW	9	15322654	missense	probably benign	0.19
R4543:Cep295	UTSW	9	15335253	missense	possibly damaging	0.94
R4584:Cep295	UTSW	9	15334799	missense	possibly damaging	0.96
R4724:Cep295	UTSW	9	15330832	missense	probably damaging	1.00
R4878:Cep295	UTSW	9	15334956	missense	probably benign	0.11
R4884:Cep295	UTSW	9	15351760	missense	probably damaging	1.00
R4934:Cep295	UTSW	9	15333160	missense	probably damaging	0.97
R4990:Cep295	UTSW	9	15332138	missense	probably damaging	1.00
R5057:Cep295	UTSW	9	15322683	missense	probably benign	0.00
R5153:Cep295	UTSW	9	15357629	missense	probably benign	0.32
R5180:Cep295	UTSW	9	15332120	missense	probably benign
R5285:Cep295	UTSW	9	15322591	missense	probably benign	0.14
R5360:Cep295	UTSW	9	15326733	missense	probably damaging	1.00
R5419:Cep295	UTSW	9	15324237	missense	probably damaging	0.98
R5432:Cep295	UTSW	9	15351695	missense	possibly damaging	0.95
R5625:Cep295	UTSW	9	15340891	missense	probably damaging	0.99
R5637:Cep295	UTSW	9	15333812	splice site	probably null
R5645:Cep295	UTSW	9	15332794	missense	probably damaging	0.98
R5645:Cep295	UTSW	9	15335108	missense	possibly damaging	0.89
R5678:Cep295	UTSW	9	15322858	missense	probably damaging	0.99
R5688:Cep295	UTSW	9	15331986	missense	probably damaging	1.00
R5807:Cep295	UTSW	9	15332532	missense	probably damaging	1.00
R5824:Cep295	UTSW	9	15325656	missense	possibly damaging	0.90
R5837:Cep295	UTSW	9	15346984	missense	probably damaging	0.99
R5915:Cep295	UTSW	9	15341479	missense	probably damaging	1.00
R5988:Cep295	UTSW	9	15341474	missense	probably damaging	1.00
R6239:Cep295	UTSW	9	15322631	missense	possibly damaging	0.46
R6332:Cep295	UTSW	9	15334914	missense	possibly damaging	0.90
R6383:Cep295	UTSW	9	15332754	missense	probably damaging	0.99
R6737:Cep295	UTSW	9	15332351	missense	possibly damaging	0.90
R6929:Cep295	UTSW	9	15333062	missense	probably damaging	1.00
R7428:Cep295	UTSW	9	15333498	missense	possibly damaging	0.61
R7697:Cep295	UTSW	9	15354710	missense	probably benign	0.01
R7963:Cep295	UTSW	9	15333441	missense	possibly damaging	0.90
R8055:Cep295	UTSW	9	15333609	missense	probably benign	0.00
R8069:Cep295	UTSW	9	15322586	missense	possibly damaging	0.94
R8092:Cep295	UTSW	9	15332982	missense	probably benign	0.17
R8117:Cep295	UTSW	9	15334364	missense	probably damaging	0.99
R8140:Cep295	UTSW	9	15341533	missense	probably benign	0.00
R8178:Cep295	UTSW	9	15333540	missense
R8323:Cep295	UTSW	9	15338233	missense	possibly damaging	0.53
R8323:Cep295	UTSW	9	15353061	missense	probably damaging	0.96
R8339:Cep295	UTSW	9	15325550	missense
R8351:Cep295	UTSW	9	15322906	missense	probably damaging	0.99
R8367:Cep295	UTSW	9	15334530	missense	probably benign	0.09
R8725:Cep295	UTSW	9	15332419	nonsense	probably null
R8919:Cep295	UTSW	9	15326711	missense	probably damaging	1.00
R9015:Cep295	UTSW	9	15332968	missense	probably benign	0.00
R9054:Cep295	UTSW	9	15324255	missense	possibly damaging	0.92
R9088:Cep295	UTSW	9	15322519	missense	probably benign	0.09
R9159:Cep295	UTSW	9	15341608	missense	probably benign	0.05
R9243:Cep295	UTSW	9	15332309	missense	probably benign	0.36
R9424:Cep295	UTSW	9	15333203	missense	probably damaging	0.98
R9455:Cep295	UTSW	9	15333750	missense	possibly damaging	0.90
X0065:Cep295	UTSW	9	15322891	missense	probably benign	0.36
Z1176:Cep295	UTSW	9	15357697	missense	probably damaging	0.99
Z1177:Cep295	UTSW	9	15330817	missense

Predicted Primers

PCR Primer
(F):5'- GCTGCAGTTCTGGTATCTGAAG -3'
(R):5'- TCAACAGACTGATGCCTTGTC -3'

Sequencing Primer
(F):5'- ATCTGAAGATGGCTTGACTTGAC -3'
(R):5'- AACATCCCGGGGGTCTGTATC -3'

Posted On

2022-05-16