Incidental Mutation 'R9408:Ppwd1'
ID 711684
Institutional Source Beutler Lab
Gene Symbol Ppwd1
Ensembl Gene ENSMUSG00000021713
Gene Name peptidylprolyl isomerase domain and WD repeat containing 1
Synonyms 4632422M10Rik, A330090G21Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock # R9408 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 104205124-104228843 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104209647 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 500 (M500T)
Ref Sequence ENSEMBL: ENSMUSP00000022226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022226]
AlphaFold Q8CEC6
Predicted Effect possibly damaging
Transcript: ENSMUST00000022226
AA Change: M500T

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000022226
Gene: ENSMUSG00000021713
AA Change: M500T

DomainStartEndE-ValueType
WD40 80 117 2.96e-2 SMART
WD40 122 161 8.49e-3 SMART
Blast:WD40 164 207 9e-6 BLAST
WD40 211 251 2.76e0 SMART
WD40 269 308 1.4e-3 SMART
Blast:WD40 343 382 2e-6 BLAST
Blast:WD40 433 460 3e-7 BLAST
Pfam:Pro_isomerase 493 645 1.9e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 G A 6: 128,545,067 T1264I probably damaging Het
Aadac T A 3: 60,039,565 V228E probably benign Het
Abca4 A T 3: 122,137,625 R1436W probably benign Het
Abo A G 2: 26,848,275 L39S probably benign Het
Acnat1 T A 4: 49,447,773 R269S probably benign Het
Adap2 T C 11: 80,155,116 V74A probably damaging Het
Ahctf1 C A 1: 179,776,073 A803S possibly damaging Het
Ak6 A G 13: 100,655,495 S149G probably benign Het
Ank T C 15: 27,591,502 V444A probably damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Atf7 A C 15: 102,553,851 V112G probably damaging Het
Brca2 A G 5: 150,541,517 Y1582C probably damaging Het
Bricd5 G T 17: 24,474,109 probably benign Het
Bsn C A 9: 108,139,453 E120* probably null Het
Cacna1g T G 11: 94,430,224 N1348T probably damaging Het
Ccnc T G 4: 21,746,776 probably null Het
Cd163 A G 6: 124,320,538 D881G probably benign Het
Cep295 G A 9: 15,333,323 P1279L probably benign Het
Cic G A 7: 25,271,989 V382I possibly damaging Het
Cyp21a1 G A 17: 34,801,886 S453F probably damaging Het
D16Ertd472e A T 16: 78,547,758 I154N probably benign Het
Dbf4 A G 5: 8,397,764 V482A possibly damaging Het
Dchs2 G A 3: 83,285,266 V1673M probably benign Het
Dctd T A 8: 48,137,350 C119S probably damaging Het
Dock1 A G 7: 135,115,336 T1234A probably damaging Het
Eya4 A T 10: 23,123,907 M386K Het
Fbxw19 T A 9: 109,486,033 M154L probably benign Het
Frmpd1 T A 4: 45,279,182 S636T probably benign Het
Glb1l A T 1: 75,201,039 Y412N probably damaging Het
Gm11639 T A 11: 104,730,429 probably null Het
Gm9833 T A 3: 10,089,347 M392K probably benign Het
Gnb5 T A 9: 75,311,414 L7Q probably damaging Het
Gpr19 C T 6: 134,887,741 V3M unknown Het
Hivep2 A G 10: 14,131,761 T1368A probably damaging Het
Hmx3 A T 7: 131,544,373 Q270L probably damaging Het
Il1rap A T 16: 26,714,925 I524F possibly damaging Het
Mettl17 G A 14: 51,888,034 G198D probably damaging Het
Mga T A 2: 119,935,518 I1421N possibly damaging Het
Myb T A 10: 21,150,376 Q231L probably benign Het
Myf5 G A 10: 107,485,666 T89I probably damaging Het
Nup214 T A 2: 32,047,511 L1999Q probably damaging Het
Olfr1152 G A 2: 87,868,035 G15R probably damaging Het
Olfr1249 A G 2: 89,630,044 Y285H probably damaging Het
Olfr1352 A G 10: 78,984,386 M199V probably benign Het
Olfr1378 T A 11: 50,969,786 L256Q probably damaging Het
Olfr432 T C 1: 174,050,763 L130P Het
Olfr574 A T 7: 102,949,236 H257L probably damaging Het
Otog A T 7: 46,267,297 D886V possibly damaging Het
Pde7a A C 3: 19,233,794 V237G possibly damaging Het
Pigs T C 11: 78,339,387 Y327H probably damaging Het
Pkd2l2 T C 18: 34,430,330 V478A probably damaging Het
Pnrc1 C A 4: 33,246,488 G157V probably damaging Het
Poglut1 G T 16: 38,526,775 S343R probably benign Het
Pyy C T 11: 102,107,285 G23E probably damaging Het
Ripor3 T A 2: 167,989,318 D521V probably benign Het
Rnpepl1 T C 1: 92,917,702 S448P probably benign Het
Sash1 G A 10: 8,762,230 probably benign Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Synj1 C T 16: 90,944,852 C1252Y probably benign Het
Tenm2 A T 11: 36,069,419 L1027Q probably damaging Het
Tep1 A G 14: 50,837,180 V1796A possibly damaging Het
Timp3 A T 10: 86,300,918 E22V possibly damaging Het
Tlk1 A C 2: 70,786,875 probably null Het
Tmco1 C A 1: 167,314,131 T69K Het
Topaz1 T A 9: 122,797,663 M1452K probably benign Het
Tsc22d2 T C 3: 58,460,032 Y668H unknown Het
Uri1 A T 7: 37,969,606 D153E probably benign Het
Vmn1r169 A T 7: 23,577,917 T245S probably damaging Het
Vmn1r60 A G 7: 5,544,919 Y61H Het
Zfp541 A T 7: 16,072,214 E91D probably damaging Het
Zfp946 A G 17: 22,454,588 N108D possibly damaging Het
Zpr1 T C 9: 46,275,449 L194P probably damaging Het
Zzef1 T A 11: 72,864,827 N1027K possibly damaging Het
Other mutations in Ppwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ppwd1 APN 13 104217143 missense probably damaging 1.00
IGL01582:Ppwd1 APN 13 104213704 missense probably benign 0.01
IGL01697:Ppwd1 APN 13 104220464 missense probably benign 0.01
IGL01771:Ppwd1 APN 13 104217116 missense probably damaging 1.00
IGL02414:Ppwd1 APN 13 104223137 missense probably benign
IGL02803:Ppwd1 APN 13 104213684 missense probably benign 0.00
IGL02873:Ppwd1 APN 13 104209753 missense probably damaging 1.00
F5770:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
R0462:Ppwd1 UTSW 13 104222960 critical splice acceptor site probably null
R1638:Ppwd1 UTSW 13 104220263 missense probably damaging 1.00
R2211:Ppwd1 UTSW 13 104207142 missense probably benign 0.26
R2226:Ppwd1 UTSW 13 104217245 missense probably damaging 1.00
R2299:Ppwd1 UTSW 13 104220063 missense probably benign
R2353:Ppwd1 UTSW 13 104213582 missense probably benign
R2382:Ppwd1 UTSW 13 104207113 missense probably damaging 1.00
R3123:Ppwd1 UTSW 13 104213690 missense possibly damaging 0.90
R4521:Ppwd1 UTSW 13 104209659 missense probably benign 0.16
R4972:Ppwd1 UTSW 13 104220108 missense probably benign 0.00
R5125:Ppwd1 UTSW 13 104220435 missense probably benign 0.14
R5178:Ppwd1 UTSW 13 104220435 missense probably benign 0.14
R5468:Ppwd1 UTSW 13 104225444 missense possibly damaging 0.52
R5638:Ppwd1 UTSW 13 104220398 missense probably damaging 1.00
R6748:Ppwd1 UTSW 13 104208030 nonsense probably null
R7095:Ppwd1 UTSW 13 104205626 missense probably benign 0.21
R7201:Ppwd1 UTSW 13 104207172 missense probably damaging 1.00
R7206:Ppwd1 UTSW 13 104213598 missense probably damaging 0.99
R7664:Ppwd1 UTSW 13 104220290 missense probably damaging 1.00
R7746:Ppwd1 UTSW 13 104217206 missense probably damaging 1.00
R9259:Ppwd1 UTSW 13 104223104 missense probably damaging 1.00
R9354:Ppwd1 UTSW 13 104205572 missense probably benign 0.00
V7580:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
V7581:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTGTCCTCACAATAGGCTGC -3'
(R):5'- GGTAAGTTGTTTAATTCAGCTGCTC -3'

Sequencing Primer
(F):5'- GTCCTCACAATAGGCTGCATTAAAAG -3'
(R):5'- GTTTAATTCAGCTGCTCACATTTTC -3'
Posted On 2022-05-16