Incidental Mutation 'R9408:Tep1'
ID 711685
Institutional Source Beutler Lab
Gene Symbol Tep1
Ensembl Gene ENSMUSG00000006281
Gene Name telomerase associated protein 1
Synonyms Tp1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9408 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 50824059-50870560 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 50837180 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1796 (V1796A)
Ref Sequence ENSEMBL: ENSMUSP00000006444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006444] [ENSMUST00000227526]
AlphaFold P97499
Predicted Effect possibly damaging
Transcript: ENSMUST00000006444
AA Change: V1796A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: V1796A

DomainStartEndE-ValueType
Pfam:TEP1_N 1 29 2.8e-20 PFAM
Pfam:TEP1_N 31 59 1.4e-20 PFAM
Pfam:TEP1_N 61 89 3.1e-20 PFAM
Pfam:TEP1_N 91 119 3e-20 PFAM
low complexity region 195 207 N/A INTRINSIC
low complexity region 211 229 N/A INTRINSIC
Pfam:TROVE 230 685 3.2e-136 PFAM
Pfam:DUF4062 909 1020 2.4e-22 PFAM
Pfam:NACHT 1171 1346 9.2e-38 PFAM
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1622 1641 N/A INTRINSIC
WD40 1673 1711 2.98e-1 SMART
WD40 1714 1752 5.33e0 SMART
WD40 1755 1794 1.52e-4 SMART
WD40 1797 1835 3.27e-4 SMART
WD40 1838 1877 3.09e-1 SMART
WD40 1880 1919 2.24e-2 SMART
WD40 1925 1962 4.95e0 SMART
WD40 1968 2003 2.29e1 SMART
WD40 2008 2045 1.72e0 SMART
WD40 2058 2097 3.89e-11 SMART
WD40 2103 2142 3.93e-7 SMART
WD40 2145 2182 4.38e-5 SMART
WD40 2184 2232 1.24e0 SMART
WD40 2235 2273 1.14e-3 SMART
WD40 2275 2315 4.46e-1 SMART
Blast:WD40 2316 2353 4e-12 BLAST
WD40 2546 2583 6.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226430
Predicted Effect probably benign
Transcript: ENSMUST00000227526
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 G A 6: 128,545,067 T1264I probably damaging Het
Aadac T A 3: 60,039,565 V228E probably benign Het
Abca4 A T 3: 122,137,625 R1436W probably benign Het
Abo A G 2: 26,848,275 L39S probably benign Het
Acnat1 T A 4: 49,447,773 R269S probably benign Het
Adap2 T C 11: 80,155,116 V74A probably damaging Het
Ahctf1 C A 1: 179,776,073 A803S possibly damaging Het
Ak6 A G 13: 100,655,495 S149G probably benign Het
Ank T C 15: 27,591,502 V444A probably damaging Het
Armt1 AC A 10: 4,450,848 probably null Het
Atf7 A C 15: 102,553,851 V112G probably damaging Het
Brca2 A G 5: 150,541,517 Y1582C probably damaging Het
Bricd5 G T 17: 24,474,109 probably benign Het
Bsn C A 9: 108,139,453 E120* probably null Het
Cacna1g T G 11: 94,430,224 N1348T probably damaging Het
Ccnc T G 4: 21,746,776 probably null Het
Cd163 A G 6: 124,320,538 D881G probably benign Het
Cep295 G A 9: 15,333,323 P1279L probably benign Het
Cic G A 7: 25,271,989 V382I possibly damaging Het
Cyp21a1 G A 17: 34,801,886 S453F probably damaging Het
D16Ertd472e A T 16: 78,547,758 I154N probably benign Het
Dbf4 A G 5: 8,397,764 V482A possibly damaging Het
Dchs2 G A 3: 83,285,266 V1673M probably benign Het
Dctd T A 8: 48,137,350 C119S probably damaging Het
Dock1 A G 7: 135,115,336 T1234A probably damaging Het
Eya4 A T 10: 23,123,907 M386K Het
Fbxw19 T A 9: 109,486,033 M154L probably benign Het
Frmpd1 T A 4: 45,279,182 S636T probably benign Het
Glb1l A T 1: 75,201,039 Y412N probably damaging Het
Gm11639 T A 11: 104,730,429 probably null Het
Gm9833 T A 3: 10,089,347 M392K probably benign Het
Gnb5 T A 9: 75,311,414 L7Q probably damaging Het
Gpr19 C T 6: 134,887,741 V3M unknown Het
Hivep2 A G 10: 14,131,761 T1368A probably damaging Het
Hmx3 A T 7: 131,544,373 Q270L probably damaging Het
Il1rap A T 16: 26,714,925 I524F possibly damaging Het
Mettl17 G A 14: 51,888,034 G198D probably damaging Het
Mga T A 2: 119,935,518 I1421N possibly damaging Het
Myb T A 10: 21,150,376 Q231L probably benign Het
Myf5 G A 10: 107,485,666 T89I probably damaging Het
Nup214 T A 2: 32,047,511 L1999Q probably damaging Het
Olfr1152 G A 2: 87,868,035 G15R probably damaging Het
Olfr1249 A G 2: 89,630,044 Y285H probably damaging Het
Olfr1352 A G 10: 78,984,386 M199V probably benign Het
Olfr1378 T A 11: 50,969,786 L256Q probably damaging Het
Olfr432 T C 1: 174,050,763 L130P Het
Olfr574 A T 7: 102,949,236 H257L probably damaging Het
Otog A T 7: 46,267,297 D886V possibly damaging Het
Pde7a A C 3: 19,233,794 V237G possibly damaging Het
Pigs T C 11: 78,339,387 Y327H probably damaging Het
Pkd2l2 T C 18: 34,430,330 V478A probably damaging Het
Pnrc1 C A 4: 33,246,488 G157V probably damaging Het
Poglut1 G T 16: 38,526,775 S343R probably benign Het
Ppwd1 A G 13: 104,209,647 M500T possibly damaging Het
Pyy C T 11: 102,107,285 G23E probably damaging Het
Ripor3 T A 2: 167,989,318 D521V probably benign Het
Rnpepl1 T C 1: 92,917,702 S448P probably benign Het
Sash1 G A 10: 8,762,230 probably benign Het
Sbf2 T C 7: 110,441,495 Q375R possibly damaging Het
Synj1 C T 16: 90,944,852 C1252Y probably benign Het
Tenm2 A T 11: 36,069,419 L1027Q probably damaging Het
Timp3 A T 10: 86,300,918 E22V possibly damaging Het
Tlk1 A C 2: 70,786,875 probably null Het
Tmco1 C A 1: 167,314,131 T69K Het
Topaz1 T A 9: 122,797,663 M1452K probably benign Het
Tsc22d2 T C 3: 58,460,032 Y668H unknown Het
Uri1 A T 7: 37,969,606 D153E probably benign Het
Vmn1r169 A T 7: 23,577,917 T245S probably damaging Het
Vmn1r60 A G 7: 5,544,919 Y61H Het
Zfp541 A T 7: 16,072,214 E91D probably damaging Het
Zfp946 A G 17: 22,454,588 N108D possibly damaging Het
Zpr1 T C 9: 46,275,449 L194P probably damaging Het
Zzef1 T A 11: 72,864,827 N1027K possibly damaging Het
Other mutations in Tep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Tep1 APN 14 50843184 missense probably damaging 1.00
IGL00490:Tep1 APN 14 50833473 missense probably damaging 0.97
IGL01114:Tep1 APN 14 50850639 missense probably damaging 0.98
IGL01294:Tep1 APN 14 50829657 splice site probably benign
IGL01902:Tep1 APN 14 50866091 splice site probably benign
IGL01910:Tep1 APN 14 50844112 missense probably benign 0.06
IGL01925:Tep1 APN 14 50824498 unclassified probably benign
IGL01965:Tep1 APN 14 50863495 splice site probably benign
IGL02071:Tep1 APN 14 50834049 missense possibly damaging 0.93
IGL02124:Tep1 APN 14 50854124 unclassified probably benign
IGL02189:Tep1 APN 14 50826826 missense probably benign
IGL02252:Tep1 APN 14 50830255 missense possibly damaging 0.93
IGL02299:Tep1 APN 14 50840671 missense probably damaging 0.99
IGL02343:Tep1 APN 14 50829247 missense probably damaging 0.99
IGL02423:Tep1 APN 14 50844620 missense possibly damaging 0.53
IGL02537:Tep1 APN 14 50836113 missense probably damaging 0.96
IGL02601:Tep1 APN 14 50833478 nonsense probably null
IGL02941:Tep1 APN 14 50866037 missense probably damaging 0.98
IGL02990:Tep1 APN 14 50868246 missense possibly damaging 0.86
IGL03144:Tep1 APN 14 50844017 splice site probably benign
IGL03209:Tep1 APN 14 50840703 splice site probably benign
R0240_Tep1_347 UTSW 14 50863029 splice site probably benign
R0972_Tep1_893 UTSW 14 50824296 unclassified probably benign
R1686_Tep1_375 UTSW 14 50836788 missense probably benign 0.12
R7232_Tep1_671 UTSW 14 50844332 missense unknown
R8009_Tep1_822 UTSW 14 50824230 missense possibly damaging 0.93
PIT4305001:Tep1 UTSW 14 50829227 missense possibly damaging 0.90
PIT4362001:Tep1 UTSW 14 50866053 missense probably benign 0.23
R0058:Tep1 UTSW 14 50834065 missense possibly damaging 0.85
R0060:Tep1 UTSW 14 50866029 missense probably damaging 1.00
R0109:Tep1 UTSW 14 50851916 splice site probably null
R0123:Tep1 UTSW 14 50829693 missense possibly damaging 0.84
R0134:Tep1 UTSW 14 50829693 missense possibly damaging 0.84
R0148:Tep1 UTSW 14 50824789 missense possibly damaging 0.70
R0240:Tep1 UTSW 14 50863029 splice site probably benign
R0243:Tep1 UTSW 14 50846987 missense probably damaging 1.00
R0373:Tep1 UTSW 14 50836768 missense possibly damaging 0.85
R0432:Tep1 UTSW 14 50866823 small deletion probably benign
R0464:Tep1 UTSW 14 50847684 missense probably benign 0.00
R0566:Tep1 UTSW 14 50845414 critical splice donor site probably null
R0691:Tep1 UTSW 14 50866844 nonsense probably null
R0787:Tep1 UTSW 14 50829230 missense possibly damaging 0.85
R0972:Tep1 UTSW 14 50824296 unclassified probably benign
R1263:Tep1 UTSW 14 50845513 missense possibly damaging 0.84
R1300:Tep1 UTSW 14 50827055 critical splice donor site probably null
R1327:Tep1 UTSW 14 50853099 missense probably benign 0.18
R1556:Tep1 UTSW 14 50853042 missense probably benign 0.06
R1584:Tep1 UTSW 14 50866037 missense probably damaging 0.98
R1607:Tep1 UTSW 14 50824563 missense probably null 0.99
R1686:Tep1 UTSW 14 50836788 missense probably benign 0.12
R1715:Tep1 UTSW 14 50854567 missense possibly damaging 0.92
R1778:Tep1 UTSW 14 50829622 intron probably benign
R1993:Tep1 UTSW 14 50824184 missense possibly damaging 0.93
R2071:Tep1 UTSW 14 50854282 missense probably benign 0.23
R2104:Tep1 UTSW 14 50850580 splice site probably benign
R2118:Tep1 UTSW 14 50855572 splice site probably null
R2119:Tep1 UTSW 14 50838986 missense probably benign 0.13
R2208:Tep1 UTSW 14 50866864 missense probably benign 0.01
R2241:Tep1 UTSW 14 50854210 missense probably benign 0.01
R2243:Tep1 UTSW 14 50854210 missense probably benign 0.01
R2311:Tep1 UTSW 14 50833567 missense possibly damaging 0.95
R2420:Tep1 UTSW 14 50834023 missense probably benign
R2874:Tep1 UTSW 14 50850650 missense possibly damaging 0.71
R3084:Tep1 UTSW 14 50827054 critical splice donor site probably null
R3086:Tep1 UTSW 14 50827054 critical splice donor site probably null
R3621:Tep1 UTSW 14 50829020 missense probably damaging 0.99
R3815:Tep1 UTSW 14 50868315 missense possibly damaging 0.71
R4124:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4125:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4127:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4134:Tep1 UTSW 14 50844860 missense probably benign
R4152:Tep1 UTSW 14 50837594 missense possibly damaging 0.72
R4153:Tep1 UTSW 14 50837594 missense possibly damaging 0.72
R4191:Tep1 UTSW 14 50836806 missense probably damaging 0.96
R4248:Tep1 UTSW 14 50862894 missense possibly damaging 0.93
R4293:Tep1 UTSW 14 50846861 missense probably benign
R4569:Tep1 UTSW 14 50824740 missense probably benign 0.01
R4704:Tep1 UTSW 14 50837073 missense probably benign 0.06
R4815:Tep1 UTSW 14 50841302 missense probably damaging 0.99
R4978:Tep1 UTSW 14 50845434 missense possibly damaging 0.93
R4989:Tep1 UTSW 14 50839000 missense probably benign
R5022:Tep1 UTSW 14 50828999 missense probably benign 0.27
R5057:Tep1 UTSW 14 50828999 missense probably benign 0.27
R5063:Tep1 UTSW 14 50850627 missense possibly damaging 0.86
R5118:Tep1 UTSW 14 50855587 splice site probably null
R5128:Tep1 UTSW 14 50844279 makesense probably null
R5149:Tep1 UTSW 14 50837398 nonsense probably null
R5171:Tep1 UTSW 14 50824802 missense probably benign 0.01
R5201:Tep1 UTSW 14 50868110 missense probably benign 0.01
R5260:Tep1 UTSW 14 50838631 missense probably benign
R5339:Tep1 UTSW 14 50844574 missense probably damaging 0.99
R5384:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5385:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5386:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5594:Tep1 UTSW 14 50829882 missense possibly damaging 0.86
R5639:Tep1 UTSW 14 50853605 missense possibly damaging 0.85
R5749:Tep1 UTSW 14 50844072 missense possibly damaging 0.59
R5756:Tep1 UTSW 14 50837379 critical splice donor site probably null
R6013:Tep1 UTSW 14 50861048 missense probably damaging 0.97
R6014:Tep1 UTSW 14 50847000 missense probably benign 0.12
R6248:Tep1 UTSW 14 50830258 missense probably damaging 0.98
R6264:Tep1 UTSW 14 50845513 missense probably damaging 0.99
R6363:Tep1 UTSW 14 50824548 missense probably benign 0.04
R6381:Tep1 UTSW 14 50845431 missense probably damaging 0.99
R6462:Tep1 UTSW 14 50844379 missense probably benign
R6942:Tep1 UTSW 14 50836737 missense possibly damaging 0.85
R6951:Tep1 UTSW 14 50833913 critical splice donor site probably null
R6979:Tep1 UTSW 14 50838637 missense possibly damaging 0.93
R6999:Tep1 UTSW 14 50850705 missense possibly damaging 0.86
R7099:Tep1 UTSW 14 50844487 splice site probably null
R7208:Tep1 UTSW 14 50824556 critical splice acceptor site probably null
R7232:Tep1 UTSW 14 50844332 missense unknown
R7249:Tep1 UTSW 14 50824275 missense possibly damaging 0.86
R7325:Tep1 UTSW 14 50866038 missense probably damaging 0.99
R7409:Tep1 UTSW 14 50866855 missense possibly damaging 0.67
R7499:Tep1 UTSW 14 50853590 missense probably damaging 0.99
R7542:Tep1 UTSW 14 50862491 nonsense probably null
R7806:Tep1 UTSW 14 50836809 missense possibly damaging 0.85
R7825:Tep1 UTSW 14 50843887 critical splice acceptor site probably null
R7901:Tep1 UTSW 14 50826851 missense possibly damaging 0.88
R7961:Tep1 UTSW 14 50824230 missense possibly damaging 0.93
R7993:Tep1 UTSW 14 50830253 missense probably benign 0.41
R8009:Tep1 UTSW 14 50824230 missense possibly damaging 0.93
R8085:Tep1 UTSW 14 50829296 missense probably benign 0.11
R8299:Tep1 UTSW 14 50868045 missense probably benign 0.06
R8330:Tep1 UTSW 14 50847705 missense possibly damaging 0.86
R8396:Tep1 UTSW 14 50837072 missense probably benign 0.23
R8475:Tep1 UTSW 14 50841255 missense probably damaging 1.00
R8695:Tep1 UTSW 14 50845437 missense possibly damaging 0.85
R8726:Tep1 UTSW 14 50847623 missense probably damaging 0.98
R8812:Tep1 UTSW 14 50837132 missense probably damaging 0.98
R9152:Tep1 UTSW 14 50866705 missense probably benign 0.14
R9269:Tep1 UTSW 14 50844309 missense probably damaging 0.98
R9365:Tep1 UTSW 14 50827140 missense probably damaging 1.00
R9398:Tep1 UTSW 14 50828972 missense possibly damaging 0.85
R9445:Tep1 UTSW 14 50845510 missense possibly damaging 0.95
R9487:Tep1 UTSW 14 50829230 missense possibly damaging 0.93
R9555:Tep1 UTSW 14 50868431 missense not run
R9597:Tep1 UTSW 14 50863008 missense not run
RF007:Tep1 UTSW 14 50860945 missense possibly damaging 0.92
X0024:Tep1 UTSW 14 50827119 missense possibly damaging 0.86
X0060:Tep1 UTSW 14 50836764 missense probably benign 0.25
Z1177:Tep1 UTSW 14 50847765 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGACATGGAATATAGCTGTCACTC -3'
(R):5'- TCAACCATGAGCCGAAACTG -3'

Sequencing Primer
(F):5'- ATGGAATATAGCTGTCACTCTCCAC -3'
(R):5'- CCATGAGCCGAAACTGATTTTG -3'
Posted On 2022-05-16