Incidental Mutation 'R9409:Grin2c'
ID 711715
Institutional Source Beutler Lab
Gene Symbol Grin2c
Ensembl Gene ENSMUSG00000020734
Gene Name glutamate receptor, ionotropic, NMDA2C (epsilon 3)
Synonyms NR2C, NMDAR2C, GluRepsilon3
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.421) question?
Stock # R9409 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 115139995-115158069 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 115144106 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 697 (R697H)
Ref Sequence ENSEMBL: ENSMUSP00000003351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003351] [ENSMUST00000106554]
AlphaFold Q01098
Predicted Effect probably benign
Transcript: ENSMUST00000003351
AA Change: R697H

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000003351
Gene: ENSMUSG00000020734
AA Change: R697H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 99 299 5.1e-12 PFAM
PBPe 440 796 1.11e-79 SMART
Lig_chan-Glu_bd 448 500 2.79e-18 SMART
transmembrane domain 816 835 N/A INTRINSIC
Pfam:NMDAR2_C 837 924 6.8e-15 PFAM
low complexity region 941 975 N/A INTRINSIC
low complexity region 1041 1058 N/A INTRINSIC
low complexity region 1063 1076 N/A INTRINSIC
low complexity region 1173 1182 N/A INTRINSIC
low complexity region 1194 1203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106554
AA Change: R697H

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102164
Gene: ENSMUSG00000020734
AA Change: R697H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 100 306 6.9e-10 PFAM
PBPe 440 796 1.11e-79 SMART
Lig_chan-Glu_bd 448 500 2.79e-18 SMART
transmembrane domain 816 835 N/A INTRINSIC
Pfam:NMDAR2_C 837 926 1.1e-13 PFAM
low complexity region 941 975 N/A INTRINSIC
low complexity region 1041 1058 N/A INTRINSIC
low complexity region 1063 1076 N/A INTRINSIC
low complexity region 1173 1182 N/A INTRINSIC
low complexity region 1194 1203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptor, which is a subtype of ionotropic glutamate receptor. NMDA receptors are found in the central nervous system, are permeable to cations and have an important role in physiological processes such as learning, memory, and synaptic development. The receptor is a tetramer of different subunits (typically heterodimer of subunit 1 with one or more of subunits 2A-D), forming a channel that is permeable to calcium, potassium, and sodium, and whose properties are determined by subunit composition. Alterations in the subunit composition of the receptor are associated with pathophysiological conditions such as Parkinson's disease, Alzheimer's disease, depression, and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit deficits in motor coordination and reduced granule cell responses to N-methy-D-aspartate in brain slices. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A T 8: 73,211,888 (GRCm39) I538F possibly damaging Het
Arih2 C G 9: 108,488,938 (GRCm39) R260P probably damaging Het
Ccdc138 A G 10: 58,374,135 (GRCm39) H385R probably damaging Het
Cep43 T C 17: 8,411,088 (GRCm39) V367A probably benign Het
Cfhr1 T C 1: 139,478,704 (GRCm39) D222G probably benign Het
Cpb2 A T 14: 75,505,522 (GRCm39) I173F probably damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Ebf2 T C 14: 67,472,665 (GRCm39) S28P probably damaging Het
Eomes A T 9: 118,314,069 (GRCm39) T705S probably benign Het
Fbxo15 T A 18: 84,977,246 (GRCm39) W98R possibly damaging Het
Gm12258 T C 11: 58,745,119 (GRCm39) F17L Het
Ighmbp2 C A 19: 3,318,832 (GRCm39) A415S possibly damaging Het
Il6st C G 13: 112,640,872 (GRCm39) Q883E probably benign Het
Med17 T C 9: 15,176,695 (GRCm39) M511V probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Or8b39 G A 9: 37,996,584 (GRCm39) G151R probably damaging Het
Pacrg A T 17: 10,996,065 (GRCm39) I67N probably damaging Het
Pam A G 1: 97,749,585 (GRCm39) S964P probably damaging Het
Pcdh15 A G 10: 74,160,190 (GRCm39) T436A probably damaging Het
Pgap4 T A 4: 49,586,043 (GRCm39) E375V probably damaging Het
Rag1 A T 2: 101,473,192 (GRCm39) L650Q probably damaging Het
Rhobtb1 A T 10: 69,106,217 (GRCm39) T323S probably benign Het
Rhot2 T C 17: 26,060,085 (GRCm39) T299A probably benign Het
Rnf180 CGAGG CGAGGAGG 13: 105,386,781 (GRCm39) probably benign Het
Ryr2 C A 13: 11,695,973 (GRCm39) V2965F probably damaging Het
Serpina1b A T 12: 103,694,607 (GRCm39) M379K probably benign Het
Serpinb9 A G 13: 33,192,797 (GRCm39) Q118R probably benign Het
Slc16a14 G A 1: 84,907,116 (GRCm39) Q53* probably null Het
Tas2r130 T A 6: 131,607,660 (GRCm39) D45V probably damaging Het
Tie1 T C 4: 118,339,945 (GRCm39) N361D probably damaging Het
Tmtc2 G T 10: 105,159,419 (GRCm39) L560M probably damaging Het
Trav13-5 G T 14: 54,033,277 (GRCm39) R62L possibly damaging Het
Other mutations in Grin2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Grin2c APN 11 115,148,936 (GRCm39) missense possibly damaging 0.94
IGL01306:Grin2c APN 11 115,147,020 (GRCm39) missense probably benign 0.01
IGL01408:Grin2c APN 11 115,151,708 (GRCm39) missense probably damaging 1.00
IGL01539:Grin2c APN 11 115,140,932 (GRCm39) missense probably benign 0.32
IGL01931:Grin2c APN 11 115,144,736 (GRCm39) missense probably damaging 1.00
IGL01964:Grin2c APN 11 115,144,673 (GRCm39) missense probably damaging 1.00
IGL02796:Grin2c APN 11 115,141,543 (GRCm39) splice site probably benign
IGL02956:Grin2c APN 11 115,148,785 (GRCm39) missense possibly damaging 0.86
IGL03221:Grin2c APN 11 115,144,870 (GRCm39) splice site probably benign
ANU23:Grin2c UTSW 11 115,147,020 (GRCm39) missense probably benign 0.01
BB007:Grin2c UTSW 11 115,147,063 (GRCm39) missense probably benign 0.01
BB017:Grin2c UTSW 11 115,147,063 (GRCm39) missense probably benign 0.01
PIT4362001:Grin2c UTSW 11 115,140,459 (GRCm39) missense probably benign
R0011:Grin2c UTSW 11 115,146,576 (GRCm39) missense probably damaging 1.00
R0011:Grin2c UTSW 11 115,146,576 (GRCm39) missense probably damaging 1.00
R0112:Grin2c UTSW 11 115,141,960 (GRCm39) missense probably damaging 1.00
R0355:Grin2c UTSW 11 115,151,554 (GRCm39) splice site probably benign
R0681:Grin2c UTSW 11 115,140,479 (GRCm39) missense probably benign
R0791:Grin2c UTSW 11 115,141,472 (GRCm39) missense probably damaging 1.00
R0792:Grin2c UTSW 11 115,141,472 (GRCm39) missense probably damaging 1.00
R1512:Grin2c UTSW 11 115,144,676 (GRCm39) missense probably damaging 1.00
R1572:Grin2c UTSW 11 115,146,900 (GRCm39) missense possibly damaging 0.92
R1654:Grin2c UTSW 11 115,151,679 (GRCm39) missense probably benign 0.21
R1803:Grin2c UTSW 11 115,151,558 (GRCm39) critical splice donor site probably null
R1982:Grin2c UTSW 11 115,151,731 (GRCm39) missense possibly damaging 0.96
R2050:Grin2c UTSW 11 115,148,245 (GRCm39) missense possibly damaging 0.89
R2196:Grin2c UTSW 11 115,141,492 (GRCm39) missense probably benign 0.34
R2442:Grin2c UTSW 11 115,141,960 (GRCm39) missense probably damaging 1.00
R2509:Grin2c UTSW 11 115,141,894 (GRCm39) nonsense probably null
R3440:Grin2c UTSW 11 115,141,469 (GRCm39) missense probably damaging 1.00
R3965:Grin2c UTSW 11 115,151,820 (GRCm39) missense probably damaging 1.00
R4618:Grin2c UTSW 11 115,143,573 (GRCm39) missense probably damaging 1.00
R4735:Grin2c UTSW 11 115,140,422 (GRCm39) missense possibly damaging 0.63
R4856:Grin2c UTSW 11 115,151,616 (GRCm39) missense probably damaging 1.00
R4886:Grin2c UTSW 11 115,151,616 (GRCm39) missense probably damaging 1.00
R5277:Grin2c UTSW 11 115,144,639 (GRCm39) missense probably damaging 1.00
R5334:Grin2c UTSW 11 115,146,881 (GRCm39) missense possibly damaging 0.76
R5553:Grin2c UTSW 11 115,143,551 (GRCm39) missense probably null 0.96
R5711:Grin2c UTSW 11 115,141,115 (GRCm39) missense probably benign 0.32
R5784:Grin2c UTSW 11 115,149,121 (GRCm39) missense possibly damaging 0.94
R5849:Grin2c UTSW 11 115,151,817 (GRCm39) missense probably benign
R6421:Grin2c UTSW 11 115,141,956 (GRCm39) missense probably damaging 1.00
R6461:Grin2c UTSW 11 115,146,522 (GRCm39) missense possibly damaging 0.96
R6658:Grin2c UTSW 11 115,149,108 (GRCm39) missense possibly damaging 0.64
R7205:Grin2c UTSW 11 115,141,876 (GRCm39) missense probably damaging 0.99
R7611:Grin2c UTSW 11 115,143,511 (GRCm39) missense probably damaging 1.00
R7637:Grin2c UTSW 11 115,147,085 (GRCm39) splice site probably null
R7751:Grin2c UTSW 11 115,144,696 (GRCm39) missense probably damaging 1.00
R7847:Grin2c UTSW 11 115,151,804 (GRCm39) missense possibly damaging 0.68
R7920:Grin2c UTSW 11 115,144,970 (GRCm39) missense probably benign 0.33
R7930:Grin2c UTSW 11 115,147,063 (GRCm39) missense probably benign 0.01
R7940:Grin2c UTSW 11 115,146,107 (GRCm39) missense probably damaging 1.00
R7956:Grin2c UTSW 11 115,140,974 (GRCm39) missense probably benign 0.16
R8081:Grin2c UTSW 11 115,140,719 (GRCm39) missense probably damaging 0.98
R8249:Grin2c UTSW 11 115,144,663 (GRCm39) missense probably damaging 0.98
R8447:Grin2c UTSW 11 115,148,215 (GRCm39) missense probably benign 0.01
R9034:Grin2c UTSW 11 115,142,065 (GRCm39) missense probably damaging 1.00
R9432:Grin2c UTSW 11 115,142,052 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACCTCAAACATCTGGGTCATATG -3'
(R):5'- GTGTCTAAGACTGTGCAGGG -3'

Sequencing Primer
(F):5'- GACATGCCAGCTCCACTGTC -3'
(R):5'- CTAAGACTGTGCAGGGGCTGG -3'
Posted On 2022-05-16