Incidental Mutation 'R9410:Ndufa10'
ID 711731
Institutional Source Beutler Lab
Gene Symbol Ndufa10
Ensembl Gene ENSMUSG00000026260
Gene Name NADH:ubiquinone oxidoreductase subunit A10
Synonyms 2900053E13Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 92367208-92401547 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 92367614 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 339 (Y339N)
Ref Sequence ENSEMBL: ENSMUSP00000027478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027478] [ENSMUST00000189503]
AlphaFold Q99LC3
Predicted Effect probably damaging
Transcript: ENSMUST00000027478
AA Change: Y339N

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027478
Gene: ENSMUSG00000026260
AA Change: Y339N

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:dNK 60 287 2.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189503
SMART Domains Protein: ENSMUSP00000140576
Gene: ENSMUSG00000026260

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of 42 kDa complex I, the first enzyme complex in the electron transport chain of mitochondria. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. A mutation in this gene was found in an individual with Leigh syndrome. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,869,703 (GRCm39) S772L probably benign Het
Ampd2 A T 3: 107,982,590 (GRCm39) V722E probably damaging Het
Appbp2 A T 11: 85,106,067 (GRCm39) F83Y probably damaging Het
Arih2 C G 9: 108,488,938 (GRCm39) R260P probably damaging Het
B020004C17Rik A T 14: 57,254,273 (GRCm39) Y132F possibly damaging Het
Cnr1 A G 4: 33,944,973 (GRCm39) T454A possibly damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Ctla4 A T 1: 60,951,911 (GRCm39) T147S probably damaging Het
Ctsa T C 2: 164,677,101 (GRCm39) L152P probably damaging Het
Dgkh T C 14: 78,862,293 (GRCm39) T225A probably damaging Het
Dsg1a A T 18: 20,464,590 (GRCm39) I362F possibly damaging Het
Dzank1 C T 2: 144,324,050 (GRCm39) probably null Het
Ephb2 A T 4: 136,386,948 (GRCm39) C760S probably null Het
Exoc1 T A 5: 76,706,989 (GRCm39) V512E probably benign Het
Faiml C A 9: 99,111,587 (GRCm39) K157N probably benign Het
Fpr2 C T 17: 18,113,604 (GRCm39) T200I probably benign Het
Fscn3 C T 6: 28,430,432 (GRCm39) R201* probably null Het
Hcrtr1 A T 4: 130,029,514 (GRCm39) L189Q probably damaging Het
Igkv4-62 T C 6: 69,376,832 (GRCm39) T84A probably benign Het
Krtap2-4 C A 11: 99,505,437 (GRCm39) R58L possibly damaging Het
Meis1 C T 11: 18,833,987 (GRCm39) probably null Het
Mfsd2b T A 12: 4,915,747 (GRCm39) I422F probably damaging Het
Mre11a G A 9: 14,716,716 (GRCm39) V304M probably damaging Het
Myo5a A G 9: 75,023,496 (GRCm39) E19G probably damaging Het
Odad1 T C 7: 45,597,821 (GRCm39) V577A probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,481,663 (GRCm39) probably null Het
Pcdh18 G A 3: 49,699,615 (GRCm39) P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Plin4 A G 17: 56,413,995 (GRCm39) V210A probably benign Het
Rnf150 T C 8: 83,762,722 (GRCm39) M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,386,781 (GRCm39) probably benign Het
Ruvbl2 G A 7: 45,071,618 (GRCm39) Q422* probably null Het
Shroom1 C T 11: 53,354,217 (GRCm39) R46C probably damaging Het
Slc22a2 T C 17: 12,805,732 (GRCm39) F161S probably damaging Het
Src T A 2: 157,311,676 (GRCm39) M468K probably damaging Het
Stag3 T C 5: 138,297,601 (GRCm39) F606L possibly damaging Het
Stau1 T C 2: 166,797,038 (GRCm39) T120A probably benign Het
Sulf2 A C 2: 165,936,444 (GRCm39) L174R Het
Sumf1 A C 6: 108,150,363 (GRCm39) F156C probably damaging Het
Tenm2 T A 11: 36,032,396 (GRCm39) D708V probably damaging Het
Tmprss12 A C 15: 100,190,622 (GRCm39) I331L possibly damaging Het
Tnfrsf10b T G 14: 70,010,849 (GRCm39) C85G probably damaging Het
Trav10d C A 14: 53,048,845 (GRCm39) Q79K probably benign Het
Vmn1r236 T A 17: 21,507,756 (GRCm39) Y291* probably null Het
Vmn2r115 T C 17: 23,578,915 (GRCm39) I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 (GRCm39) H348Q possibly damaging Het
Zfp563 T A 17: 33,321,320 (GRCm39) L40Q probably damaging Het
Other mutations in Ndufa10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02793:Ndufa10 APN 1 92,397,639 (GRCm39) missense probably damaging 1.00
IGL03116:Ndufa10 APN 1 92,392,109 (GRCm39) nonsense probably null
R0136:Ndufa10 UTSW 1 92,390,850 (GRCm39) nonsense probably null
R0627:Ndufa10 UTSW 1 92,397,618 (GRCm39) missense probably damaging 1.00
R2024:Ndufa10 UTSW 1 92,367,614 (GRCm39) missense probably damaging 0.99
R2025:Ndufa10 UTSW 1 92,367,614 (GRCm39) missense probably damaging 0.99
R2026:Ndufa10 UTSW 1 92,367,614 (GRCm39) missense probably damaging 0.99
R4694:Ndufa10 UTSW 1 92,379,824 (GRCm39) missense probably benign 0.00
R4895:Ndufa10 UTSW 1 92,397,618 (GRCm39) missense probably damaging 1.00
R5423:Ndufa10 UTSW 1 92,390,042 (GRCm39) missense probably benign
R5785:Ndufa10 UTSW 1 92,388,096 (GRCm39) splice site probably null
R7011:Ndufa10 UTSW 1 92,398,581 (GRCm39) missense probably damaging 0.99
R7383:Ndufa10 UTSW 1 92,392,183 (GRCm39) missense probably damaging 0.98
R7868:Ndufa10 UTSW 1 92,388,169 (GRCm39) missense probably damaging 0.99
R8290:Ndufa10 UTSW 1 92,390,869 (GRCm39) missense possibly damaging 0.57
R8431:Ndufa10 UTSW 1 92,379,732 (GRCm39) critical splice donor site probably null
R8885:Ndufa10 UTSW 1 92,397,693 (GRCm39) missense probably damaging 1.00
R9758:Ndufa10 UTSW 1 92,379,752 (GRCm39) missense probably benign 0.02
R9789:Ndufa10 UTSW 1 92,397,610 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GTGGACGCTGATTCTTTCATC -3'
(R):5'- TCTGGATCTCTGTCCTGGAC -3'

Sequencing Primer
(F):5'- TCATCTCTGCCCAGGCGTG -3'
(R):5'- CAGGACTTCTGTGGGCAAG -3'
Posted On 2022-05-16