Incidental Mutation 'R9410:Dzank1'
ID 711733
Institutional Source Beutler Lab
Gene Symbol Dzank1
Ensembl Gene ENSMUSG00000037259
Gene Name double zinc ribbon and ankyrin repeat domains 1
Synonyms 2810039F03Rik, 6330439K17Rik, Ankrd64
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 144312477-144369334 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 144324050 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081982] [ENSMUST00000081982] [ENSMUST00000163701]
AlphaFold Q8C008
Predicted Effect probably null
Transcript: ENSMUST00000081982
SMART Domains Protein: ENSMUSP00000080643
Gene: ENSMUSG00000037259

DomainStartEndE-ValueType
Pfam:CHB_HEX_C 11 99 1.1e-16 PFAM
Pfam:CHB_HEX_C_1 20 97 4.5e-18 PFAM
Pfam:Fn3_assoc 32 100 1.6e-17 PFAM
ZnF_RBZ 268 292 5.44e0 SMART
ZnF_RBZ 307 331 2.55e0 SMART
Blast:ZnF_RBZ 355 378 1e-7 BLAST
ZnF_RBZ 385 409 3.13e0 SMART
low complexity region 591 604 N/A INTRINSIC
ANK 631 662 2.97e2 SMART
ANK 666 695 2.83e0 SMART
Blast:ANK 700 731 7e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000081982
SMART Domains Protein: ENSMUSP00000080643
Gene: ENSMUSG00000037259

DomainStartEndE-ValueType
Pfam:CHB_HEX_C 11 99 1.1e-16 PFAM
Pfam:CHB_HEX_C_1 20 97 4.5e-18 PFAM
Pfam:Fn3_assoc 32 100 1.6e-17 PFAM
ZnF_RBZ 268 292 5.44e0 SMART
ZnF_RBZ 307 331 2.55e0 SMART
Blast:ZnF_RBZ 355 378 1e-7 BLAST
ZnF_RBZ 385 409 3.13e0 SMART
low complexity region 591 604 N/A INTRINSIC
ANK 631 662 2.97e2 SMART
ANK 666 695 2.83e0 SMART
Blast:ANK 700 731 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163701
SMART Domains Protein: ENSMUSP00000133177
Gene: ENSMUSG00000037259

DomainStartEndE-ValueType
Pfam:CHB_HEX_C 12 99 1.5e-17 PFAM
Pfam:CHB_HEX_C_1 21 97 8.5e-17 PFAM
Pfam:Fn3_assoc 32 100 3.7e-18 PFAM
ZnF_RBZ 269 293 5.44e0 SMART
ZnF_RBZ 308 332 2.55e0 SMART
Blast:ZnF_RBZ 356 379 1e-7 BLAST
ZnF_RBZ 386 410 3.13e0 SMART
low complexity region 592 605 N/A INTRINSIC
ANK 632 663 2.97e2 SMART
ANK 667 696 2.83e0 SMART
Blast:ANK 701 732 7e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains two ankyrin repeat-encoding regions. Ankyrin repeats are tandemly repeated modules of about 33 amino acids described as L-shaped structures consisting of a beta-hairpin and two alpha-helices. Ankyrin repeats occur in a large number of functionally diverse proteins, mainly from eukaryotes, and are known to function as protein-protein interaction domains. Alternative splicing has been observed for this gene but the full-length nature of additional variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,869,703 (GRCm39) S772L probably benign Het
Ampd2 A T 3: 107,982,590 (GRCm39) V722E probably damaging Het
Appbp2 A T 11: 85,106,067 (GRCm39) F83Y probably damaging Het
Arih2 C G 9: 108,488,938 (GRCm39) R260P probably damaging Het
B020004C17Rik A T 14: 57,254,273 (GRCm39) Y132F possibly damaging Het
Cnr1 A G 4: 33,944,973 (GRCm39) T454A possibly damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Ctla4 A T 1: 60,951,911 (GRCm39) T147S probably damaging Het
Ctsa T C 2: 164,677,101 (GRCm39) L152P probably damaging Het
Dgkh T C 14: 78,862,293 (GRCm39) T225A probably damaging Het
Dsg1a A T 18: 20,464,590 (GRCm39) I362F possibly damaging Het
Ephb2 A T 4: 136,386,948 (GRCm39) C760S probably null Het
Exoc1 T A 5: 76,706,989 (GRCm39) V512E probably benign Het
Faiml C A 9: 99,111,587 (GRCm39) K157N probably benign Het
Fpr2 C T 17: 18,113,604 (GRCm39) T200I probably benign Het
Fscn3 C T 6: 28,430,432 (GRCm39) R201* probably null Het
Hcrtr1 A T 4: 130,029,514 (GRCm39) L189Q probably damaging Het
Igkv4-62 T C 6: 69,376,832 (GRCm39) T84A probably benign Het
Krtap2-4 C A 11: 99,505,437 (GRCm39) R58L possibly damaging Het
Meis1 C T 11: 18,833,987 (GRCm39) probably null Het
Mfsd2b T A 12: 4,915,747 (GRCm39) I422F probably damaging Het
Mre11a G A 9: 14,716,716 (GRCm39) V304M probably damaging Het
Myo5a A G 9: 75,023,496 (GRCm39) E19G probably damaging Het
Ndufa10 A T 1: 92,367,614 (GRCm39) Y339N probably damaging Het
Odad1 T C 7: 45,597,821 (GRCm39) V577A probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,481,663 (GRCm39) probably null Het
Pcdh18 G A 3: 49,699,615 (GRCm39) P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Plin4 A G 17: 56,413,995 (GRCm39) V210A probably benign Het
Rnf150 T C 8: 83,762,722 (GRCm39) M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,386,781 (GRCm39) probably benign Het
Ruvbl2 G A 7: 45,071,618 (GRCm39) Q422* probably null Het
Shroom1 C T 11: 53,354,217 (GRCm39) R46C probably damaging Het
Slc22a2 T C 17: 12,805,732 (GRCm39) F161S probably damaging Het
Src T A 2: 157,311,676 (GRCm39) M468K probably damaging Het
Stag3 T C 5: 138,297,601 (GRCm39) F606L possibly damaging Het
Stau1 T C 2: 166,797,038 (GRCm39) T120A probably benign Het
Sulf2 A C 2: 165,936,444 (GRCm39) L174R Het
Sumf1 A C 6: 108,150,363 (GRCm39) F156C probably damaging Het
Tenm2 T A 11: 36,032,396 (GRCm39) D708V probably damaging Het
Tmprss12 A C 15: 100,190,622 (GRCm39) I331L possibly damaging Het
Tnfrsf10b T G 14: 70,010,849 (GRCm39) C85G probably damaging Het
Trav10d C A 14: 53,048,845 (GRCm39) Q79K probably benign Het
Vmn1r236 T A 17: 21,507,756 (GRCm39) Y291* probably null Het
Vmn2r115 T C 17: 23,578,915 (GRCm39) I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 (GRCm39) H348Q possibly damaging Het
Zfp563 T A 17: 33,321,320 (GRCm39) L40Q probably damaging Het
Other mutations in Dzank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dzank1 APN 2 144,323,645 (GRCm39) nonsense probably null
IGL00955:Dzank1 APN 2 144,332,094 (GRCm39) missense probably benign 0.22
IGL01888:Dzank1 APN 2 144,318,074 (GRCm39) splice site probably null
IGL02108:Dzank1 APN 2 144,348,143 (GRCm39) missense probably benign 0.02
IGL02979:Dzank1 APN 2 144,330,658 (GRCm39) missense probably damaging 1.00
BB008:Dzank1 UTSW 2 144,323,614 (GRCm39) missense probably benign 0.00
BB018:Dzank1 UTSW 2 144,323,614 (GRCm39) missense probably benign 0.00
PIT4466001:Dzank1 UTSW 2 144,325,293 (GRCm39) missense probably benign 0.00
R0388:Dzank1 UTSW 2 144,318,026 (GRCm39) missense possibly damaging 0.86
R0603:Dzank1 UTSW 2 144,353,432 (GRCm39) missense probably benign 0.04
R1052:Dzank1 UTSW 2 144,355,365 (GRCm39) missense probably benign
R1386:Dzank1 UTSW 2 144,333,751 (GRCm39) missense probably benign 0.05
R1529:Dzank1 UTSW 2 144,324,108 (GRCm39) missense probably benign 0.01
R1634:Dzank1 UTSW 2 144,323,589 (GRCm39) missense probably benign 0.01
R2761:Dzank1 UTSW 2 144,355,369 (GRCm39) missense probably benign
R4024:Dzank1 UTSW 2 144,324,147 (GRCm39) missense probably benign
R4279:Dzank1 UTSW 2 144,333,765 (GRCm39) missense probably benign 0.00
R4324:Dzank1 UTSW 2 144,330,618 (GRCm39) missense possibly damaging 0.95
R4516:Dzank1 UTSW 2 144,352,042 (GRCm39) intron probably benign
R4713:Dzank1 UTSW 2 144,333,724 (GRCm39) missense probably benign 0.13
R4782:Dzank1 UTSW 2 144,346,319 (GRCm39) missense probably damaging 1.00
R4994:Dzank1 UTSW 2 144,364,486 (GRCm39) missense probably damaging 1.00
R5157:Dzank1 UTSW 2 144,325,332 (GRCm39) missense probably damaging 0.98
R5514:Dzank1 UTSW 2 144,323,605 (GRCm39) missense probably benign 0.01
R5580:Dzank1 UTSW 2 144,348,098 (GRCm39) missense probably damaging 1.00
R5635:Dzank1 UTSW 2 144,325,327 (GRCm39) missense probably damaging 1.00
R5793:Dzank1 UTSW 2 144,348,144 (GRCm39) missense probably benign 0.14
R5820:Dzank1 UTSW 2 144,355,408 (GRCm39) missense probably damaging 1.00
R5976:Dzank1 UTSW 2 144,343,409 (GRCm39) missense probably damaging 1.00
R6935:Dzank1 UTSW 2 144,318,014 (GRCm39) missense possibly damaging 0.64
R6980:Dzank1 UTSW 2 144,332,056 (GRCm39) missense possibly damaging 0.87
R7331:Dzank1 UTSW 2 144,332,190 (GRCm39) missense probably benign 0.17
R7691:Dzank1 UTSW 2 144,348,091 (GRCm39) missense probably damaging 1.00
R7814:Dzank1 UTSW 2 144,364,484 (GRCm39) missense probably damaging 1.00
R7879:Dzank1 UTSW 2 144,333,718 (GRCm39) missense probably benign 0.01
R7931:Dzank1 UTSW 2 144,323,614 (GRCm39) missense probably benign 0.00
R8127:Dzank1 UTSW 2 144,330,736 (GRCm39) missense probably damaging 1.00
R8192:Dzank1 UTSW 2 144,332,145 (GRCm39) missense probably benign 0.05
R8314:Dzank1 UTSW 2 144,344,878 (GRCm39) missense probably damaging 1.00
R8944:Dzank1 UTSW 2 144,333,729 (GRCm39) missense probably benign 0.00
R9025:Dzank1 UTSW 2 144,318,012 (GRCm39) missense probably benign 0.04
R9096:Dzank1 UTSW 2 144,316,882 (GRCm39) missense possibly damaging 0.62
R9097:Dzank1 UTSW 2 144,316,882 (GRCm39) missense possibly damaging 0.62
R9108:Dzank1 UTSW 2 144,364,391 (GRCm39) missense probably benign 0.00
R9261:Dzank1 UTSW 2 144,355,344 (GRCm39) missense probably benign 0.20
R9418:Dzank1 UTSW 2 144,355,408 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCATGAAGGACTTTAAAAGCC -3'
(R):5'- ACTGTGCACAAGGTTCCAGG -3'

Sequencing Primer
(F):5'- TGAAGGACTTTAAAAGCCACACC -3'
(R):5'- ACAAGGTTCCAGGCCTCAG -3'
Posted On 2022-05-16