Incidental Mutation 'R9410:Src'
ID 711734
Institutional Source Beutler Lab
Gene Symbol Src
Ensembl Gene ENSMUSG00000027646
Gene Name Rous sarcoma oncogene
Synonyms pp60c-src
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.888) question?
Stock # R9410 (G1)
Quality Score 222.009
Status Not validated
Chromosome 2
Chromosomal Location 157265828-157313758 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 157311676 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 468 (M468K)
Ref Sequence ENSEMBL: ENSMUSP00000105159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029175] [ENSMUST00000092576] [ENSMUST00000109529] [ENSMUST00000109531] [ENSMUST00000109533]
AlphaFold P05480
Predicted Effect probably damaging
Transcript: ENSMUST00000029175
AA Change: M468K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029175
Gene: ENSMUSG00000027646
AA Change: M468K

DomainStartEndE-ValueType
SH3 86 143 2.48e-21 SMART
SH2 148 238 6.56e-37 SMART
TyrKc 269 518 2.97e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092576
AA Change: M474K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090237
Gene: ENSMUSG00000027646
AA Change: M474K

DomainStartEndE-ValueType
SH3 86 149 1.2e-19 SMART
SH2 154 244 6.56e-37 SMART
TyrKc 275 524 2.97e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109529
AA Change: M474K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105155
Gene: ENSMUSG00000027646
AA Change: M474K

DomainStartEndE-ValueType
SH3 86 149 1.2e-19 SMART
SH2 154 244 6.56e-37 SMART
TyrKc 275 524 2.97e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109531
AA Change: M468K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105157
Gene: ENSMUSG00000027646
AA Change: M468K

DomainStartEndE-ValueType
SH3 86 143 2.48e-21 SMART
SH2 148 238 6.56e-37 SMART
TyrKc 269 518 2.97e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109533
AA Change: M468K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105159
Gene: ENSMUSG00000027646
AA Change: M468K

DomainStartEndE-ValueType
SH3 86 143 2.48e-21 SMART
SH2 148 238 6.56e-37 SMART
TyrKc 269 518 2.97e-131 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is highly similar to the v-src gene of Rous sarcoma virus. This proto-oncogene may play a role in the regulation of embryonic development and cell growth. The protein encoded by this gene is a tyrosine-protein kinase whose activity can be inhibited by phosphorylation by c-SRC kinase. Mutations in this gene could be involved in the malignant progression of colon cancer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit growth retardation, failure of tooth eruption, osteopetrosis with lack of secondary bone resorption, and lethality at 3-4 weeks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,869,703 (GRCm39) S772L probably benign Het
Ampd2 A T 3: 107,982,590 (GRCm39) V722E probably damaging Het
Appbp2 A T 11: 85,106,067 (GRCm39) F83Y probably damaging Het
Arih2 C G 9: 108,488,938 (GRCm39) R260P probably damaging Het
B020004C17Rik A T 14: 57,254,273 (GRCm39) Y132F possibly damaging Het
Cnr1 A G 4: 33,944,973 (GRCm39) T454A possibly damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Ctla4 A T 1: 60,951,911 (GRCm39) T147S probably damaging Het
Ctsa T C 2: 164,677,101 (GRCm39) L152P probably damaging Het
Dgkh T C 14: 78,862,293 (GRCm39) T225A probably damaging Het
Dsg1a A T 18: 20,464,590 (GRCm39) I362F possibly damaging Het
Dzank1 C T 2: 144,324,050 (GRCm39) probably null Het
Ephb2 A T 4: 136,386,948 (GRCm39) C760S probably null Het
Exoc1 T A 5: 76,706,989 (GRCm39) V512E probably benign Het
Faiml C A 9: 99,111,587 (GRCm39) K157N probably benign Het
Fpr2 C T 17: 18,113,604 (GRCm39) T200I probably benign Het
Fscn3 C T 6: 28,430,432 (GRCm39) R201* probably null Het
Hcrtr1 A T 4: 130,029,514 (GRCm39) L189Q probably damaging Het
Igkv4-62 T C 6: 69,376,832 (GRCm39) T84A probably benign Het
Krtap2-4 C A 11: 99,505,437 (GRCm39) R58L possibly damaging Het
Meis1 C T 11: 18,833,987 (GRCm39) probably null Het
Mfsd2b T A 12: 4,915,747 (GRCm39) I422F probably damaging Het
Mre11a G A 9: 14,716,716 (GRCm39) V304M probably damaging Het
Myo5a A G 9: 75,023,496 (GRCm39) E19G probably damaging Het
Ndufa10 A T 1: 92,367,614 (GRCm39) Y339N probably damaging Het
Odad1 T C 7: 45,597,821 (GRCm39) V577A probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,481,663 (GRCm39) probably null Het
Pcdh18 G A 3: 49,699,615 (GRCm39) P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Plin4 A G 17: 56,413,995 (GRCm39) V210A probably benign Het
Rnf150 T C 8: 83,762,722 (GRCm39) M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,386,781 (GRCm39) probably benign Het
Ruvbl2 G A 7: 45,071,618 (GRCm39) Q422* probably null Het
Shroom1 C T 11: 53,354,217 (GRCm39) R46C probably damaging Het
Slc22a2 T C 17: 12,805,732 (GRCm39) F161S probably damaging Het
Stag3 T C 5: 138,297,601 (GRCm39) F606L possibly damaging Het
Stau1 T C 2: 166,797,038 (GRCm39) T120A probably benign Het
Sulf2 A C 2: 165,936,444 (GRCm39) L174R Het
Sumf1 A C 6: 108,150,363 (GRCm39) F156C probably damaging Het
Tenm2 T A 11: 36,032,396 (GRCm39) D708V probably damaging Het
Tmprss12 A C 15: 100,190,622 (GRCm39) I331L possibly damaging Het
Tnfrsf10b T G 14: 70,010,849 (GRCm39) C85G probably damaging Het
Trav10d C A 14: 53,048,845 (GRCm39) Q79K probably benign Het
Vmn1r236 T A 17: 21,507,756 (GRCm39) Y291* probably null Het
Vmn2r115 T C 17: 23,578,915 (GRCm39) I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 (GRCm39) H348Q possibly damaging Het
Zfp563 T A 17: 33,321,320 (GRCm39) L40Q probably damaging Het
Other mutations in Src
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Src APN 2 157,311,423 (GRCm39) missense probably damaging 1.00
IGL01320:Src APN 2 157,311,423 (GRCm39) missense probably damaging 1.00
IGL01323:Src APN 2 157,311,423 (GRCm39) missense probably damaging 1.00
IGL01452:Src APN 2 157,304,903 (GRCm39) missense probably damaging 1.00
IGL02618:Src APN 2 157,306,698 (GRCm39) nonsense probably null
R0605:Src UTSW 2 157,311,841 (GRCm39) missense probably damaging 1.00
R1457:Src UTSW 2 157,311,132 (GRCm39) missense probably damaging 1.00
R1471:Src UTSW 2 157,299,107 (GRCm39) nonsense probably null
R1694:Src UTSW 2 157,311,675 (GRCm39) missense possibly damaging 0.95
R2040:Src UTSW 2 157,299,030 (GRCm39) missense probably benign 0.02
R2209:Src UTSW 2 157,304,710 (GRCm39) missense probably benign 0.16
R4112:Src UTSW 2 157,304,946 (GRCm39) missense probably damaging 1.00
R4414:Src UTSW 2 157,306,573 (GRCm39) missense probably damaging 1.00
R4581:Src UTSW 2 157,304,958 (GRCm39) missense probably damaging 0.98
R4661:Src UTSW 2 157,311,852 (GRCm39) missense probably damaging 1.00
R4781:Src UTSW 2 157,309,405 (GRCm39) missense possibly damaging 0.71
R5504:Src UTSW 2 157,306,641 (GRCm39) missense probably damaging 1.00
R5913:Src UTSW 2 157,307,950 (GRCm39) critical splice donor site probably null
R6166:Src UTSW 2 157,310,442 (GRCm39) missense probably damaging 0.99
R6336:Src UTSW 2 157,299,075 (GRCm39) missense probably benign 0.04
R7707:Src UTSW 2 157,306,578 (GRCm39) missense probably damaging 1.00
R7709:Src UTSW 2 157,299,164 (GRCm39) missense probably benign 0.00
R9046:Src UTSW 2 157,307,795 (GRCm39) missense probably damaging 0.99
R9372:Src UTSW 2 157,311,808 (GRCm39) missense possibly damaging 0.76
R9453:Src UTSW 2 157,307,852 (GRCm39) missense probably damaging 1.00
Z1176:Src UTSW 2 157,309,459 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ATACCTGTGTCCCTGACCTTGG -3'
(R):5'- GTGGCTCAGTGGACGTAAAG -3'

Sequencing Primer
(F):5'- TGGGGGCAAGTCTCACC -3'
(R):5'- CTCAGTGGACGTAAAGTAGTCTTCC -3'
Posted On 2022-05-16