Incidental Mutation 'R9410:Ctsa'
ID 711735
Institutional Source Beutler Lab
Gene Symbol Ctsa
Ensembl Gene ENSMUSG00000017760
Gene Name cathepsin A
Synonyms PPCA, Ppgb
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.311) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 164674793-164682952 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 164677101 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 152 (L152P)
Ref Sequence ENSEMBL: ENSMUSP00000099382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042775] [ENSMUST00000059954] [ENSMUST00000103092] [ENSMUST00000103093] [ENSMUST00000109316] [ENSMUST00000109317] [ENSMUST00000127650] [ENSMUST00000143780] [ENSMUST00000151493]
AlphaFold P16675
Predicted Effect probably benign
Transcript: ENSMUST00000042775
SMART Domains Protein: ENSMUSP00000041806
Gene: ENSMUSG00000039873

DomainStartEndE-ValueType
Pfam:Neuralized 25 90 1.1e-27 PFAM
SOCS_box 248 285 3.77e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059954
SMART Domains Protein: ENSMUSP00000061519
Gene: ENSMUSG00000017754

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
BPI1 25 243 5.93e-83 SMART
BPI2 258 460 1.35e-68 SMART
low complexity region 477 493 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103092
AA Change: L170P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099381
Gene: ENSMUSG00000017760
AA Change: L170P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 471 1.7e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103093
AA Change: L152P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099382
Gene: ENSMUSG00000017760
AA Change: L152P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 471 1.7e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109316
SMART Domains Protein: ENSMUSP00000104939
Gene: ENSMUSG00000017754

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
BPI1 25 243 5.93e-83 SMART
BPI2 258 460 1.35e-68 SMART
low complexity region 477 493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109317
SMART Domains Protein: ENSMUSP00000104940
Gene: ENSMUSG00000017754

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
BPI1 25 191 1.77e-40 SMART
BPI2 206 408 1.35e-68 SMART
low complexity region 425 441 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127650
AA Change: L152P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115514
Gene: ENSMUSG00000017760
AA Change: L152P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 215 9.4e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143780
SMART Domains Protein: ENSMUSP00000123413
Gene: ENSMUSG00000017760

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Peptidase_S10 34 144 2.1e-52 PFAM
Pfam:Peptidase_S10 141 208 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151493
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein with deamidase, esterase and carboxypeptidase activities. The encoded protein associates with and provides a protective function to the lysosomal enzymes beta-galactosidase and neuraminidase. Deficiency of the related gene in humans results in galactosialidosis. The proprotein is processed into two shorter chains. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutants show aberrant lysosomal storage, with vacuolization in specific cells of most tissues. An abormally flat face and reduced body size are apparent at birth, and health progressively deteriorates, with accompanying generalized edema, ataxia and tremors. Death occurs at ~12 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,869,703 (GRCm39) S772L probably benign Het
Ampd2 A T 3: 107,982,590 (GRCm39) V722E probably damaging Het
Appbp2 A T 11: 85,106,067 (GRCm39) F83Y probably damaging Het
Arih2 C G 9: 108,488,938 (GRCm39) R260P probably damaging Het
B020004C17Rik A T 14: 57,254,273 (GRCm39) Y132F possibly damaging Het
Cnr1 A G 4: 33,944,973 (GRCm39) T454A possibly damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Ctla4 A T 1: 60,951,911 (GRCm39) T147S probably damaging Het
Dgkh T C 14: 78,862,293 (GRCm39) T225A probably damaging Het
Dsg1a A T 18: 20,464,590 (GRCm39) I362F possibly damaging Het
Dzank1 C T 2: 144,324,050 (GRCm39) probably null Het
Ephb2 A T 4: 136,386,948 (GRCm39) C760S probably null Het
Exoc1 T A 5: 76,706,989 (GRCm39) V512E probably benign Het
Faiml C A 9: 99,111,587 (GRCm39) K157N probably benign Het
Fpr2 C T 17: 18,113,604 (GRCm39) T200I probably benign Het
Fscn3 C T 6: 28,430,432 (GRCm39) R201* probably null Het
Hcrtr1 A T 4: 130,029,514 (GRCm39) L189Q probably damaging Het
Igkv4-62 T C 6: 69,376,832 (GRCm39) T84A probably benign Het
Krtap2-4 C A 11: 99,505,437 (GRCm39) R58L possibly damaging Het
Meis1 C T 11: 18,833,987 (GRCm39) probably null Het
Mfsd2b T A 12: 4,915,747 (GRCm39) I422F probably damaging Het
Mre11a G A 9: 14,716,716 (GRCm39) V304M probably damaging Het
Myo5a A G 9: 75,023,496 (GRCm39) E19G probably damaging Het
Ndufa10 A T 1: 92,367,614 (GRCm39) Y339N probably damaging Het
Odad1 T C 7: 45,597,821 (GRCm39) V577A probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,481,663 (GRCm39) probably null Het
Pcdh18 G A 3: 49,699,615 (GRCm39) P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Plin4 A G 17: 56,413,995 (GRCm39) V210A probably benign Het
Rnf150 T C 8: 83,762,722 (GRCm39) M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,386,781 (GRCm39) probably benign Het
Ruvbl2 G A 7: 45,071,618 (GRCm39) Q422* probably null Het
Shroom1 C T 11: 53,354,217 (GRCm39) R46C probably damaging Het
Slc22a2 T C 17: 12,805,732 (GRCm39) F161S probably damaging Het
Src T A 2: 157,311,676 (GRCm39) M468K probably damaging Het
Stag3 T C 5: 138,297,601 (GRCm39) F606L possibly damaging Het
Stau1 T C 2: 166,797,038 (GRCm39) T120A probably benign Het
Sulf2 A C 2: 165,936,444 (GRCm39) L174R Het
Sumf1 A C 6: 108,150,363 (GRCm39) F156C probably damaging Het
Tenm2 T A 11: 36,032,396 (GRCm39) D708V probably damaging Het
Tmprss12 A C 15: 100,190,622 (GRCm39) I331L possibly damaging Het
Tnfrsf10b T G 14: 70,010,849 (GRCm39) C85G probably damaging Het
Trav10d C A 14: 53,048,845 (GRCm39) Q79K probably benign Het
Vmn1r236 T A 17: 21,507,756 (GRCm39) Y291* probably null Het
Vmn2r115 T C 17: 23,578,915 (GRCm39) I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 (GRCm39) H348Q possibly damaging Het
Zfp563 T A 17: 33,321,320 (GRCm39) L40Q probably damaging Het
Other mutations in Ctsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Ctsa APN 2 164,676,230 (GRCm39) unclassified probably benign
IGL02489:Ctsa APN 2 164,680,565 (GRCm39) missense probably damaging 0.96
IGL02522:Ctsa APN 2 164,681,061 (GRCm39) unclassified probably benign
IGL03008:Ctsa APN 2 164,679,368 (GRCm39) missense probably damaging 1.00
R2058:Ctsa UTSW 2 164,676,822 (GRCm39) missense probably null 0.00
R2402:Ctsa UTSW 2 164,676,813 (GRCm39) missense probably benign 0.36
R3123:Ctsa UTSW 2 164,677,152 (GRCm39) splice site probably null
R4270:Ctsa UTSW 2 164,677,222 (GRCm39) missense probably benign 0.00
R4588:Ctsa UTSW 2 164,676,070 (GRCm39) missense possibly damaging 0.62
R5236:Ctsa UTSW 2 164,680,831 (GRCm39) missense probably damaging 1.00
R5331:Ctsa UTSW 2 164,676,229 (GRCm39) unclassified probably benign
R6258:Ctsa UTSW 2 164,676,281 (GRCm39) missense probably damaging 1.00
R6260:Ctsa UTSW 2 164,676,281 (GRCm39) missense probably damaging 1.00
R6853:Ctsa UTSW 2 164,679,284 (GRCm39) missense probably benign 0.00
R7654:Ctsa UTSW 2 164,680,853 (GRCm39) missense probably benign 0.38
R7822:Ctsa UTSW 2 164,681,152 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- CCCCAGAGATGGCTTGATTAG -3'
(R):5'- CTCCCTAATCCTAGGTCACAGC -3'

Sequencing Primer
(F):5'- ATGGCCTCAGAGTCCACTTTG -3'
(R):5'- CCTAATCCTAGGTCACAGCACTGTG -3'
Posted On 2022-05-16