Incidental Mutation 'R9410:Stau1'
ID 711737
Institutional Source Beutler Lab
Gene Symbol Stau1
Ensembl Gene ENSMUSG00000039536
Gene Name staufen double-stranded RNA binding protein 1
Synonyms 5830401L18Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 166789469-166838219 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 166797038 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 120 (T120A)
Ref Sequence ENSEMBL: ENSMUSP00000104861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049412] [ENSMUST00000109235] [ENSMUST00000109236] [ENSMUST00000109238] [ENSMUST00000184390]
AlphaFold Q9Z108
Predicted Effect probably benign
Transcript: ENSMUST00000049412
SMART Domains Protein: ENSMUSP00000042626
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 199 265 5.54e-22 SMART
PDB:4DKK|A 355 469 2e-69 PDB
Blast:DSRM 401 466 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109235
SMART Domains Protein: ENSMUSP00000104858
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 199 265 5.54e-22 SMART
PDB:4DKK|A 355 469 3e-69 PDB
Blast:DSRM 401 466 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109236
SMART Domains Protein: ENSMUSP00000104859
Gene: ENSMUSG00000039536

DomainStartEndE-ValueType
Blast:DSRM 1 73 4e-21 BLAST
DSRM 97 162 9.49e-21 SMART
DSRM 197 263 5.54e-22 SMART
PDB:4DKK|A 353 467 3e-69 PDB
Blast:DSRM 399 464 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109238
AA Change: T120A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104861
Gene: ENSMUSG00000039536
AA Change: T120A

DomainStartEndE-ValueType
Blast:DSRM 1 73 5e-21 BLAST
DSRM 97 168 4.04e-15 SMART
DSRM 205 271 5.54e-22 SMART
Pfam:Staufen_C 364 475 5.9e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184390
AA Change: T120A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000139039
Gene: ENSMUSG00000039536
AA Change: T120A

DomainStartEndE-ValueType
Blast:DSRM 1 73 4e-21 BLAST
DSRM 97 168 4.04e-15 SMART
DSRM 205 271 5.54e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Staufen is a member of the family of double-stranded RNA (dsRNA)-binding proteins involved in the transport and/or localization of mRNAs to different subcellular compartments and/or organelles. These proteins are characterized by the presence of multiple dsRNA-binding domains which are required to bind RNAs having double-stranded secondary structures. The human homologue of staufen encoded by STAU, in addition contains a microtubule- binding domain similar to that of microtubule-associated protein 1B, and binds tubulin. The STAU gene product has been shown to be present in the cytoplasm in association with the rough endoplasmic reticulum (RER), implicating this protein in the transport of mRNA via the microtubule network to the RER, the site of translation. Five transcript variants resulting from alternative splicing of STAU gene and encoding three isoforms have been described. Three of these variants encode the same isoform, however, differ in their 5'UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit hypoactivity and impaired dendrite outgrowth and spine formation. [provided by MGI curators]
Allele List at MGI

All alleles(55) : Targeted, other(1) Gene trapped(54)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,869,703 (GRCm39) S772L probably benign Het
Ampd2 A T 3: 107,982,590 (GRCm39) V722E probably damaging Het
Appbp2 A T 11: 85,106,067 (GRCm39) F83Y probably damaging Het
Arih2 C G 9: 108,488,938 (GRCm39) R260P probably damaging Het
B020004C17Rik A T 14: 57,254,273 (GRCm39) Y132F possibly damaging Het
Cnr1 A G 4: 33,944,973 (GRCm39) T454A possibly damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Ctla4 A T 1: 60,951,911 (GRCm39) T147S probably damaging Het
Ctsa T C 2: 164,677,101 (GRCm39) L152P probably damaging Het
Dgkh T C 14: 78,862,293 (GRCm39) T225A probably damaging Het
Dsg1a A T 18: 20,464,590 (GRCm39) I362F possibly damaging Het
Dzank1 C T 2: 144,324,050 (GRCm39) probably null Het
Ephb2 A T 4: 136,386,948 (GRCm39) C760S probably null Het
Exoc1 T A 5: 76,706,989 (GRCm39) V512E probably benign Het
Faiml C A 9: 99,111,587 (GRCm39) K157N probably benign Het
Fpr2 C T 17: 18,113,604 (GRCm39) T200I probably benign Het
Fscn3 C T 6: 28,430,432 (GRCm39) R201* probably null Het
Hcrtr1 A T 4: 130,029,514 (GRCm39) L189Q probably damaging Het
Igkv4-62 T C 6: 69,376,832 (GRCm39) T84A probably benign Het
Krtap2-4 C A 11: 99,505,437 (GRCm39) R58L possibly damaging Het
Meis1 C T 11: 18,833,987 (GRCm39) probably null Het
Mfsd2b T A 12: 4,915,747 (GRCm39) I422F probably damaging Het
Mre11a G A 9: 14,716,716 (GRCm39) V304M probably damaging Het
Myo5a A G 9: 75,023,496 (GRCm39) E19G probably damaging Het
Ndufa10 A T 1: 92,367,614 (GRCm39) Y339N probably damaging Het
Odad1 T C 7: 45,597,821 (GRCm39) V577A probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,481,663 (GRCm39) probably null Het
Pcdh18 G A 3: 49,699,615 (GRCm39) P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Plin4 A G 17: 56,413,995 (GRCm39) V210A probably benign Het
Rnf150 T C 8: 83,762,722 (GRCm39) M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,386,781 (GRCm39) probably benign Het
Ruvbl2 G A 7: 45,071,618 (GRCm39) Q422* probably null Het
Shroom1 C T 11: 53,354,217 (GRCm39) R46C probably damaging Het
Slc22a2 T C 17: 12,805,732 (GRCm39) F161S probably damaging Het
Src T A 2: 157,311,676 (GRCm39) M468K probably damaging Het
Stag3 T C 5: 138,297,601 (GRCm39) F606L possibly damaging Het
Sulf2 A C 2: 165,936,444 (GRCm39) L174R Het
Sumf1 A C 6: 108,150,363 (GRCm39) F156C probably damaging Het
Tenm2 T A 11: 36,032,396 (GRCm39) D708V probably damaging Het
Tmprss12 A C 15: 100,190,622 (GRCm39) I331L possibly damaging Het
Tnfrsf10b T G 14: 70,010,849 (GRCm39) C85G probably damaging Het
Trav10d C A 14: 53,048,845 (GRCm39) Q79K probably benign Het
Vmn1r236 T A 17: 21,507,756 (GRCm39) Y291* probably null Het
Vmn2r115 T C 17: 23,578,915 (GRCm39) I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 (GRCm39) H348Q possibly damaging Het
Zfp563 T A 17: 33,321,320 (GRCm39) L40Q probably damaging Het
Other mutations in Stau1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Stau1 APN 2 166,792,729 (GRCm39) missense probably benign 0.03
IGL00531:Stau1 APN 2 166,806,542 (GRCm39) missense probably benign 0.00
IGL00553:Stau1 APN 2 166,793,254 (GRCm39) missense possibly damaging 0.88
IGL02311:Stau1 APN 2 166,792,239 (GRCm39) missense probably damaging 1.00
IGL02558:Stau1 APN 2 166,792,768 (GRCm39) missense probably benign 0.10
IGL02746:Stau1 APN 2 166,796,818 (GRCm39) critical splice donor site probably null
IGL02797:Stau1 APN 2 166,791,266 (GRCm39) makesense probably null
IGL03308:Stau1 APN 2 166,792,240 (GRCm39) missense probably damaging 1.00
D4216:Stau1 UTSW 2 166,791,670 (GRCm39) missense probably benign
R0614:Stau1 UTSW 2 166,792,726 (GRCm39) missense probably damaging 1.00
R1036:Stau1 UTSW 2 166,793,235 (GRCm39) missense probably damaging 0.96
R2935:Stau1 UTSW 2 166,797,037 (GRCm39) missense probably benign 0.00
R3078:Stau1 UTSW 2 166,796,936 (GRCm39) missense possibly damaging 0.68
R4542:Stau1 UTSW 2 166,795,181 (GRCm39) missense probably damaging 1.00
R4778:Stau1 UTSW 2 166,805,442 (GRCm39) missense probably benign 0.00
R6397:Stau1 UTSW 2 166,792,927 (GRCm39) missense possibly damaging 0.83
R7208:Stau1 UTSW 2 166,805,494 (GRCm39) missense probably damaging 0.98
R7870:Stau1 UTSW 2 166,792,870 (GRCm39) missense possibly damaging 0.89
R7877:Stau1 UTSW 2 166,792,787 (GRCm39) missense possibly damaging 0.95
R8844:Stau1 UTSW 2 166,793,266 (GRCm39) missense probably benign 0.00
R9174:Stau1 UTSW 2 166,791,269 (GRCm39) missense probably damaging 0.99
R9353:Stau1 UTSW 2 166,792,267 (GRCm39) missense probably damaging 1.00
R9784:Stau1 UTSW 2 166,791,695 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTCTGGGGAAGGCTCTCAC -3'
(R):5'- TTGCCTGAATGTCCAAGCTG -3'

Sequencing Primer
(F):5'- AGGCTCTCACCTTGCAGG -3'
(R):5'- CCTGAATGTCCAAGCTGTTGTG -3'
Posted On 2022-05-16