Incidental Mutation 'R9410:Pcdh18'
ID 711738
Institutional Source Beutler Lab
Gene Symbol Pcdh18
Ensembl Gene ENSMUSG00000037892
Gene Name protocadherin 18
Synonyms PCDH68L
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 49697745-49711723 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 49699615 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 949 (P949L)
Ref Sequence ENSEMBL: ENSMUSP00000039245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035931] [ENSMUST00000191794]
AlphaFold Q8VHR0
Predicted Effect probably damaging
Transcript: ENSMUST00000035931
AA Change: P949L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039245
Gene: ENSMUSG00000037892
AA Change: P949L

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
CA 51 135 1.36e-1 SMART
CA 159 244 3.78e-20 SMART
CA 268 352 1.12e-22 SMART
CA 382 463 5.76e-25 SMART
CA 487 574 2.51e-25 SMART
CA 603 684 8e-3 SMART
transmembrane domain 698 720 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
low complexity region 988 1009 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191794
SMART Domains Protein: ENSMUSP00000141995
Gene: ENSMUSG00000037892

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 51 135 6.6e-4 SMART
CA 159 244 1.9e-22 SMART
CA 268 352 5.6e-25 SMART
CA 382 463 2.7e-27 SMART
CA 487 574 1.2e-27 SMART
CA 603 684 3.9e-5 SMART
transmembrane domain 698 720 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Although its specific function is undetermined, the cadherin-related neuronal receptor is thought to play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,869,703 (GRCm39) S772L probably benign Het
Ampd2 A T 3: 107,982,590 (GRCm39) V722E probably damaging Het
Appbp2 A T 11: 85,106,067 (GRCm39) F83Y probably damaging Het
Arih2 C G 9: 108,488,938 (GRCm39) R260P probably damaging Het
B020004C17Rik A T 14: 57,254,273 (GRCm39) Y132F possibly damaging Het
Cnr1 A G 4: 33,944,973 (GRCm39) T454A possibly damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Ctla4 A T 1: 60,951,911 (GRCm39) T147S probably damaging Het
Ctsa T C 2: 164,677,101 (GRCm39) L152P probably damaging Het
Dgkh T C 14: 78,862,293 (GRCm39) T225A probably damaging Het
Dsg1a A T 18: 20,464,590 (GRCm39) I362F possibly damaging Het
Dzank1 C T 2: 144,324,050 (GRCm39) probably null Het
Ephb2 A T 4: 136,386,948 (GRCm39) C760S probably null Het
Exoc1 T A 5: 76,706,989 (GRCm39) V512E probably benign Het
Faiml C A 9: 99,111,587 (GRCm39) K157N probably benign Het
Fpr2 C T 17: 18,113,604 (GRCm39) T200I probably benign Het
Fscn3 C T 6: 28,430,432 (GRCm39) R201* probably null Het
Hcrtr1 A T 4: 130,029,514 (GRCm39) L189Q probably damaging Het
Igkv4-62 T C 6: 69,376,832 (GRCm39) T84A probably benign Het
Krtap2-4 C A 11: 99,505,437 (GRCm39) R58L possibly damaging Het
Meis1 C T 11: 18,833,987 (GRCm39) probably null Het
Mfsd2b T A 12: 4,915,747 (GRCm39) I422F probably damaging Het
Mre11a G A 9: 14,716,716 (GRCm39) V304M probably damaging Het
Myo5a A G 9: 75,023,496 (GRCm39) E19G probably damaging Het
Ndufa10 A T 1: 92,367,614 (GRCm39) Y339N probably damaging Het
Odad1 T C 7: 45,597,821 (GRCm39) V577A probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,481,663 (GRCm39) probably null Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Plin4 A G 17: 56,413,995 (GRCm39) V210A probably benign Het
Rnf150 T C 8: 83,762,722 (GRCm39) M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,386,781 (GRCm39) probably benign Het
Ruvbl2 G A 7: 45,071,618 (GRCm39) Q422* probably null Het
Shroom1 C T 11: 53,354,217 (GRCm39) R46C probably damaging Het
Slc22a2 T C 17: 12,805,732 (GRCm39) F161S probably damaging Het
Src T A 2: 157,311,676 (GRCm39) M468K probably damaging Het
Stag3 T C 5: 138,297,601 (GRCm39) F606L possibly damaging Het
Stau1 T C 2: 166,797,038 (GRCm39) T120A probably benign Het
Sulf2 A C 2: 165,936,444 (GRCm39) L174R Het
Sumf1 A C 6: 108,150,363 (GRCm39) F156C probably damaging Het
Tenm2 T A 11: 36,032,396 (GRCm39) D708V probably damaging Het
Tmprss12 A C 15: 100,190,622 (GRCm39) I331L possibly damaging Het
Tnfrsf10b T G 14: 70,010,849 (GRCm39) C85G probably damaging Het
Trav10d C A 14: 53,048,845 (GRCm39) Q79K probably benign Het
Vmn1r236 T A 17: 21,507,756 (GRCm39) Y291* probably null Het
Vmn2r115 T C 17: 23,578,915 (GRCm39) I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 (GRCm39) H348Q possibly damaging Het
Zfp563 T A 17: 33,321,320 (GRCm39) L40Q probably damaging Het
Other mutations in Pcdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Pcdh18 APN 3 49,707,828 (GRCm39) missense probably damaging 1.00
IGL00639:Pcdh18 APN 3 49,710,065 (GRCm39) missense probably benign 0.34
IGL00954:Pcdh18 APN 3 49,710,838 (GRCm39) missense probably damaging 1.00
IGL01338:Pcdh18 APN 3 49,710,590 (GRCm39) missense probably damaging 1.00
IGL01339:Pcdh18 APN 3 49,710,247 (GRCm39) missense probably benign 0.35
IGL01687:Pcdh18 APN 3 49,707,982 (GRCm39) splice site probably benign
IGL01727:Pcdh18 APN 3 49,710,149 (GRCm39) missense probably damaging 0.99
IGL01788:Pcdh18 APN 3 49,710,371 (GRCm39) nonsense probably null
IGL01824:Pcdh18 APN 3 49,709,223 (GRCm39) missense probably damaging 1.00
IGL01834:Pcdh18 APN 3 49,711,279 (GRCm39) missense probably benign 0.03
IGL01913:Pcdh18 APN 3 49,709,698 (GRCm39) missense possibly damaging 0.94
IGL01915:Pcdh18 APN 3 49,699,370 (GRCm39) missense probably benign
IGL02095:Pcdh18 APN 3 49,710,605 (GRCm39) missense probably benign 0.01
IGL02128:Pcdh18 APN 3 49,711,135 (GRCm39) missense possibly damaging 0.65
IGL02302:Pcdh18 APN 3 49,710,387 (GRCm39) missense probably benign
IGL02342:Pcdh18 APN 3 49,710,493 (GRCm39) missense probably damaging 1.00
IGL02440:Pcdh18 APN 3 49,699,052 (GRCm39) utr 3 prime probably benign
IGL02499:Pcdh18 APN 3 49,707,896 (GRCm39) missense probably benign 0.15
IGL02570:Pcdh18 APN 3 49,711,074 (GRCm39) missense probably benign 0.02
IGL02745:Pcdh18 APN 3 49,710,340 (GRCm39) missense probably damaging 1.00
IGL03073:Pcdh18 APN 3 49,707,816 (GRCm39) missense possibly damaging 0.93
PIT4469001:Pcdh18 UTSW 3 49,709,518 (GRCm39) missense probably benign
R0078:Pcdh18 UTSW 3 49,710,793 (GRCm39) missense probably damaging 1.00
R0196:Pcdh18 UTSW 3 49,711,147 (GRCm39) splice site probably null
R0524:Pcdh18 UTSW 3 49,710,091 (GRCm39) missense probably damaging 0.98
R0661:Pcdh18 UTSW 3 49,707,767 (GRCm39) missense possibly damaging 0.64
R0900:Pcdh18 UTSW 3 49,711,252 (GRCm39) missense probably benign 0.25
R1101:Pcdh18 UTSW 3 49,707,828 (GRCm39) missense probably damaging 1.00
R1463:Pcdh18 UTSW 3 49,709,854 (GRCm39) missense probably damaging 0.99
R1778:Pcdh18 UTSW 3 49,710,083 (GRCm39) missense probably benign 0.19
R1850:Pcdh18 UTSW 3 49,710,854 (GRCm39) missense probably benign 0.22
R1875:Pcdh18 UTSW 3 49,709,154 (GRCm39) missense probably damaging 0.99
R1903:Pcdh18 UTSW 3 49,709,896 (GRCm39) missense probably benign
R1956:Pcdh18 UTSW 3 49,710,400 (GRCm39) missense probably benign
R2044:Pcdh18 UTSW 3 49,709,389 (GRCm39) missense probably benign
R2303:Pcdh18 UTSW 3 49,709,723 (GRCm39) missense probably damaging 1.00
R3732:Pcdh18 UTSW 3 49,709,240 (GRCm39) missense probably benign
R3732:Pcdh18 UTSW 3 49,709,240 (GRCm39) missense probably benign
R3733:Pcdh18 UTSW 3 49,709,240 (GRCm39) missense probably benign
R3973:Pcdh18 UTSW 3 49,709,035 (GRCm39) missense probably damaging 1.00
R4281:Pcdh18 UTSW 3 49,710,982 (GRCm39) missense possibly damaging 0.76
R4601:Pcdh18 UTSW 3 49,699,174 (GRCm39) missense probably damaging 1.00
R4631:Pcdh18 UTSW 3 49,710,890 (GRCm39) missense probably damaging 0.99
R4752:Pcdh18 UTSW 3 49,709,563 (GRCm39) missense probably damaging 1.00
R4840:Pcdh18 UTSW 3 49,699,117 (GRCm39) missense probably damaging 0.98
R4867:Pcdh18 UTSW 3 49,709,113 (GRCm39) missense probably damaging 1.00
R5007:Pcdh18 UTSW 3 49,708,906 (GRCm39) missense probably benign 0.23
R5039:Pcdh18 UTSW 3 49,709,305 (GRCm39) missense probably benign
R5169:Pcdh18 UTSW 3 49,710,415 (GRCm39) missense possibly damaging 0.65
R5438:Pcdh18 UTSW 3 49,710,465 (GRCm39) nonsense probably null
R5579:Pcdh18 UTSW 3 49,699,426 (GRCm39) missense probably damaging 1.00
R6000:Pcdh18 UTSW 3 49,708,913 (GRCm39) missense probably damaging 0.99
R6220:Pcdh18 UTSW 3 49,699,700 (GRCm39) missense probably damaging 1.00
R6737:Pcdh18 UTSW 3 49,710,344 (GRCm39) missense probably damaging 0.98
R6789:Pcdh18 UTSW 3 49,710,364 (GRCm39) missense probably benign 0.00
R7011:Pcdh18 UTSW 3 49,709,231 (GRCm39) missense probably benign
R7146:Pcdh18 UTSW 3 49,710,271 (GRCm39) missense probably damaging 1.00
R7150:Pcdh18 UTSW 3 49,709,143 (GRCm39) missense probably benign 0.31
R7205:Pcdh18 UTSW 3 49,709,923 (GRCm39) missense probably benign
R7326:Pcdh18 UTSW 3 49,711,309 (GRCm39) missense probably benign
R7413:Pcdh18 UTSW 3 49,699,232 (GRCm39) missense possibly damaging 0.94
R7755:Pcdh18 UTSW 3 49,709,278 (GRCm39) missense possibly damaging 0.59
R7848:Pcdh18 UTSW 3 49,710,446 (GRCm39) missense possibly damaging 0.54
R8169:Pcdh18 UTSW 3 49,699,684 (GRCm39) missense probably damaging 1.00
R8264:Pcdh18 UTSW 3 49,711,030 (GRCm39) missense probably damaging 1.00
R8352:Pcdh18 UTSW 3 49,699,624 (GRCm39) missense possibly damaging 0.81
R8406:Pcdh18 UTSW 3 49,710,998 (GRCm39) missense probably damaging 1.00
R8452:Pcdh18 UTSW 3 49,699,624 (GRCm39) missense possibly damaging 0.81
R8489:Pcdh18 UTSW 3 49,709,038 (GRCm39) missense probably damaging 1.00
R8526:Pcdh18 UTSW 3 49,710,023 (GRCm39) missense probably damaging 1.00
R9075:Pcdh18 UTSW 3 49,699,339 (GRCm39) missense probably benign
R9285:Pcdh18 UTSW 3 49,707,786 (GRCm39) missense probably damaging 0.97
R9316:Pcdh18 UTSW 3 49,709,089 (GRCm39) missense probably damaging 1.00
R9339:Pcdh18 UTSW 3 49,709,335 (GRCm39) missense probably damaging 1.00
R9425:Pcdh18 UTSW 3 49,709,051 (GRCm39) missense possibly damaging 0.81
R9432:Pcdh18 UTSW 3 49,699,667 (GRCm39) missense probably damaging 0.96
R9547:Pcdh18 UTSW 3 49,709,506 (GRCm39) missense possibly damaging 0.79
R9567:Pcdh18 UTSW 3 49,710,884 (GRCm39) missense possibly damaging 0.95
R9622:Pcdh18 UTSW 3 49,711,229 (GRCm39) missense probably benign 0.20
R9687:Pcdh18 UTSW 3 49,711,036 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACACACTGCTCATTTCTG -3'
(R):5'- GATTCTAGCACAAAACCTCTTTCTACC -3'

Sequencing Primer
(F):5'- GGAACACACTGCTCATTTCTGATAGC -3'
(R):5'- AAGATGACATTTCCCATTGCTATG -3'
Posted On 2022-05-16