Incidental Mutation 'R9410:Hcrtr1'
ID 711742
Institutional Source Beutler Lab
Gene Symbol Hcrtr1
Ensembl Gene ENSMUSG00000028778
Gene Name hypocretin (orexin) receptor 1
Synonyms OX1R
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 130130217-130139359 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 130135721 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 189 (L189Q)
Ref Sequence ENSEMBL: ENSMUSP00000030562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030562] [ENSMUST00000119423] [ENSMUST00000120154] [ENSMUST00000164887]
AlphaFold P58307
Predicted Effect probably damaging
Transcript: ENSMUST00000030562
AA Change: L189Q

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030562
Gene: ENSMUSG00000028778
AA Change: L189Q

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119423
AA Change: L189Q

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112630
Gene: ENSMUSG00000028778
AA Change: L189Q

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 5.3e-56 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120154
AA Change: L189Q

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113198
Gene: ENSMUSG00000028778
AA Change: L189Q

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164887
AA Change: L189Q

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127290
Gene: ENSMUSG00000028778
AA Change: L189Q

DomainStartEndE-ValueType
Pfam:7tm_1 63 358 8.8e-59 PFAM
low complexity region 406 415 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in the regulation of feeding behavior. The encoded protein selectively binds the hypothalamic neuropeptide orexin A. A related gene (HCRTR2) encodes a G-protein coupled receptor that binds orexin A and orexin B. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for one null allele display increased susceptibility to pharmacologically induced seizures. Mice homozygous for a second null allele display a decrease in depression like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,905,968 S772L probably benign Het
Ampd2 A T 3: 108,075,274 V722E probably damaging Het
Appbp2 A T 11: 85,215,241 F83Y probably damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
B020004C17Rik A T 14: 57,016,816 Y132F possibly damaging Het
Ccdc114 T C 7: 45,948,397 V577A probably benign Het
Cnr1 A G 4: 33,944,973 T454A possibly damaging Het
Creb3l1 C T 2: 91,991,886 probably null Het
Ctla4 A T 1: 60,912,752 T147S probably damaging Het
Ctsa T C 2: 164,835,181 L152P probably damaging Het
Dgkh T C 14: 78,624,853 T225A probably damaging Het
Dsg1a A T 18: 20,331,533 I362F possibly damaging Het
Dzank1 C T 2: 144,482,130 probably null Het
Ephb2 A T 4: 136,659,637 C760S probably null Het
Exoc1 T A 5: 76,559,142 V512E probably benign Het
Faiml C A 9: 99,229,534 K157N probably benign Het
Fpr2 C T 17: 17,893,342 T200I probably benign Het
Fscn3 C T 6: 28,430,433 R201* probably null Het
Igkv4-62 T C 6: 69,399,848 T84A probably benign Het
Krtap2-4 C A 11: 99,614,611 R58L possibly damaging Het
Meis1 C T 11: 18,883,987 probably null Het
Mfsd2b T A 12: 4,865,747 I422F probably damaging Het
Mre11a G A 9: 14,805,420 V304M probably damaging Het
Myo5a A G 9: 75,116,214 E19G probably damaging Het
Ndufa10 A T 1: 92,439,892 Y339N probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,645,831 probably null Het
Pcdh18 G A 3: 49,745,166 P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Plin4 A G 17: 56,106,995 V210A probably benign Het
Rnf150 T C 8: 83,036,093 M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,250,273 probably benign Het
Ruvbl2 G A 7: 45,422,194 Q422* probably null Het
Shroom1 C T 11: 53,463,390 R46C probably damaging Het
Slc22a2 T C 17: 12,586,845 F161S probably damaging Het
Src T A 2: 157,469,756 M468K probably damaging Het
Stag3 T C 5: 138,299,339 F606L possibly damaging Het
Stau1 T C 2: 166,955,118 T120A probably benign Het
Sulf2 A C 2: 166,094,524 L174R Het
Sumf1 A C 6: 108,173,402 F156C probably damaging Het
Tenm2 T A 11: 36,141,569 D708V probably damaging Het
Tmprss12 A C 15: 100,292,741 I331L possibly damaging Het
Tnfrsf10b T G 14: 69,773,400 C85G probably damaging Het
Trav10d C A 14: 52,811,388 Q79K probably benign Het
Vmn1r236 T A 17: 21,287,494 Y291* probably null Het
Vmn2r115 T C 17: 23,359,941 I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 H348Q possibly damaging Het
Zfp563 T A 17: 33,102,346 L40Q probably damaging Het
Other mutations in Hcrtr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Hcrtr1 APN 4 130137269 missense probably damaging 1.00
IGL00754:Hcrtr1 APN 4 130137233 missense probably damaging 1.00
IGL02005:Hcrtr1 APN 4 130137263 missense probably benign 0.31
R0084:Hcrtr1 UTSW 4 130137266 missense possibly damaging 0.79
R0590:Hcrtr1 UTSW 4 130135694 missense probably damaging 0.96
R1531:Hcrtr1 UTSW 4 130130927 nonsense probably null
R1659:Hcrtr1 UTSW 4 130135336 nonsense probably null
R2055:Hcrtr1 UTSW 4 130130887 missense probably benign 0.08
R3028:Hcrtr1 UTSW 4 130135811 missense probably benign 0.31
R4488:Hcrtr1 UTSW 4 130135763 missense probably benign 0.02
R4967:Hcrtr1 UTSW 4 130130999 missense possibly damaging 0.69
R5301:Hcrtr1 UTSW 4 130137670 splice site probably null
R5375:Hcrtr1 UTSW 4 130135725 missense probably benign 0.08
R5636:Hcrtr1 UTSW 4 130130945 missense possibly damaging 0.59
R6283:Hcrtr1 UTSW 4 130135340 missense probably benign 0.01
R6505:Hcrtr1 UTSW 4 130137586 missense probably benign
R7018:Hcrtr1 UTSW 4 130135868 missense probably damaging 1.00
R7042:Hcrtr1 UTSW 4 130130860 unclassified probably benign
R7091:Hcrtr1 UTSW 4 130130914 missense probably damaging 0.99
R7259:Hcrtr1 UTSW 4 130135818 missense possibly damaging 0.79
R7612:Hcrtr1 UTSW 4 130135685 missense possibly damaging 0.61
R8140:Hcrtr1 UTSW 4 130135290 missense probably damaging 0.99
Z1177:Hcrtr1 UTSW 4 130133873 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTGCCCAGTCTAGTGGTGC -3'
(R):5'- GCCCTACCTCTGATGTTGTG -3'

Sequencing Primer
(F):5'- AGTCTAGTGGTGCCAGCCTG -3'
(R):5'- ACCTCTGATGTTGTGTCCCTGTG -3'
Posted On 2022-05-16