Incidental Mutation 'R9410:Ephb2'
ID 711743
Institutional Source Beutler Lab
Gene Symbol Ephb2
Ensembl Gene ENSMUSG00000028664
Gene Name Eph receptor B2
Synonyms eteck, Cek5, Qek5, Sek3, Hek5, Drt, Prkm5, Nuk, Erk, Tyro5
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.760) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 136374850-136563299 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 136386948 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 760 (C760S)
Ref Sequence ENSEMBL: ENSMUSP00000101471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059287] [ENSMUST00000105845] [ENSMUST00000105846]
AlphaFold P54763
Predicted Effect probably damaging
Transcript: ENSMUST00000059287
AA Change: C761S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058135
Gene: ENSMUSG00000028664
AA Change: C761S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 261 304 8.1e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 518 1.23e-10 SMART
Pfam:EphA2_TM 545 619 6e-25 PFAM
TyrKc 622 881 1.34e-138 SMART
SAM 911 978 1.18e-23 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105845
AA Change: C760S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101471
Gene: ENSMUSG00000028664
AA Change: C760S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 259 305 2.2e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 517 1.41e-10 SMART
Pfam:EphA2_TM 543 618 2.1e-30 PFAM
TyrKc 621 880 1.34e-138 SMART
SAM 910 977 1.18e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105846
AA Change: C761S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101472
Gene: ENSMUSG00000028664
AA Change: C761S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EPH_lbd 20 197 7.37e-130 SMART
Pfam:GCC2_GCC3 259 305 2.2e-10 PFAM
FN3 325 417 1.75e-6 SMART
FN3 436 517 1.41e-10 SMART
Pfam:EphA2_TM 543 619 1e-30 PFAM
TyrKc 622 881 1.34e-138 SMART
SAM 911 978 1.18e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156558
SMART Domains Protein: ENSMUSP00000116350
Gene: ENSMUSG00000028664

DomainStartEndE-ValueType
FN3 1 85 6.48e1 SMART
FN3 104 186 1.23e-10 SMART
Pfam:EphA2_TM 213 276 2.5e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Eph receptor family of receptor tyrosine kinase transmembrane glycoproteins. These receptors consist of an N-terminal glycosylated ligand-binding domain, a transmembrane region and an intracellular kinase domain. The encoded receptor preferentially binds membrane-bound ephrin-B ligands and is involved in nervous system and vascular development. This gene is used as a marker of intestinal stem cells. Homozygous knockout mice for this gene exhibit impaired axon guidance and vestibular function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal axon guidance, circling, head bobbing, and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,869,703 (GRCm39) S772L probably benign Het
Ampd2 A T 3: 107,982,590 (GRCm39) V722E probably damaging Het
Appbp2 A T 11: 85,106,067 (GRCm39) F83Y probably damaging Het
Arih2 C G 9: 108,488,938 (GRCm39) R260P probably damaging Het
B020004C17Rik A T 14: 57,254,273 (GRCm39) Y132F possibly damaging Het
Cnr1 A G 4: 33,944,973 (GRCm39) T454A possibly damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Ctla4 A T 1: 60,951,911 (GRCm39) T147S probably damaging Het
Ctsa T C 2: 164,677,101 (GRCm39) L152P probably damaging Het
Dgkh T C 14: 78,862,293 (GRCm39) T225A probably damaging Het
Dsg1a A T 18: 20,464,590 (GRCm39) I362F possibly damaging Het
Dzank1 C T 2: 144,324,050 (GRCm39) probably null Het
Exoc1 T A 5: 76,706,989 (GRCm39) V512E probably benign Het
Faiml C A 9: 99,111,587 (GRCm39) K157N probably benign Het
Fpr2 C T 17: 18,113,604 (GRCm39) T200I probably benign Het
Fscn3 C T 6: 28,430,432 (GRCm39) R201* probably null Het
Hcrtr1 A T 4: 130,029,514 (GRCm39) L189Q probably damaging Het
Igkv4-62 T C 6: 69,376,832 (GRCm39) T84A probably benign Het
Krtap2-4 C A 11: 99,505,437 (GRCm39) R58L possibly damaging Het
Meis1 C T 11: 18,833,987 (GRCm39) probably null Het
Mfsd2b T A 12: 4,915,747 (GRCm39) I422F probably damaging Het
Mre11a G A 9: 14,716,716 (GRCm39) V304M probably damaging Het
Myo5a A G 9: 75,023,496 (GRCm39) E19G probably damaging Het
Ndufa10 A T 1: 92,367,614 (GRCm39) Y339N probably damaging Het
Odad1 T C 7: 45,597,821 (GRCm39) V577A probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,481,663 (GRCm39) probably null Het
Pcdh18 G A 3: 49,699,615 (GRCm39) P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Plin4 A G 17: 56,413,995 (GRCm39) V210A probably benign Het
Rnf150 T C 8: 83,762,722 (GRCm39) M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,386,781 (GRCm39) probably benign Het
Ruvbl2 G A 7: 45,071,618 (GRCm39) Q422* probably null Het
Shroom1 C T 11: 53,354,217 (GRCm39) R46C probably damaging Het
Slc22a2 T C 17: 12,805,732 (GRCm39) F161S probably damaging Het
Src T A 2: 157,311,676 (GRCm39) M468K probably damaging Het
Stag3 T C 5: 138,297,601 (GRCm39) F606L possibly damaging Het
Stau1 T C 2: 166,797,038 (GRCm39) T120A probably benign Het
Sulf2 A C 2: 165,936,444 (GRCm39) L174R Het
Sumf1 A C 6: 108,150,363 (GRCm39) F156C probably damaging Het
Tenm2 T A 11: 36,032,396 (GRCm39) D708V probably damaging Het
Tmprss12 A C 15: 100,190,622 (GRCm39) I331L possibly damaging Het
Tnfrsf10b T G 14: 70,010,849 (GRCm39) C85G probably damaging Het
Trav10d C A 14: 53,048,845 (GRCm39) Q79K probably benign Het
Vmn1r236 T A 17: 21,507,756 (GRCm39) Y291* probably null Het
Vmn2r115 T C 17: 23,578,915 (GRCm39) I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 (GRCm39) H348Q possibly damaging Het
Zfp563 T A 17: 33,321,320 (GRCm39) L40Q probably damaging Het
Other mutations in Ephb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ephb2 APN 4 136,384,795 (GRCm39) missense probably damaging 0.96
IGL00963:Ephb2 APN 4 136,386,262 (GRCm39) missense probably benign 0.04
IGL01111:Ephb2 APN 4 136,384,721 (GRCm39) missense probably benign 0.01
IGL01462:Ephb2 APN 4 136,498,681 (GRCm39) missense possibly damaging 0.61
IGL01863:Ephb2 APN 4 136,387,088 (GRCm39) missense probably benign 0.03
IGL02149:Ephb2 APN 4 136,421,225 (GRCm39) missense probably damaging 1.00
IGL02232:Ephb2 APN 4 136,384,762 (GRCm39) missense probably damaging 0.97
IGL02269:Ephb2 APN 4 136,498,360 (GRCm39) missense possibly damaging 0.66
IGL02828:Ephb2 APN 4 136,498,461 (GRCm39) missense probably benign 0.09
IGL03109:Ephb2 APN 4 136,498,855 (GRCm39) missense probably damaging 1.00
IGL03284:Ephb2 APN 4 136,388,827 (GRCm39) missense probably damaging 0.96
Zimbalist UTSW 4 136,387,020 (GRCm39) missense probably damaging 1.00
BB006:Ephb2 UTSW 4 136,388,195 (GRCm39) missense probably damaging 1.00
BB016:Ephb2 UTSW 4 136,388,195 (GRCm39) missense probably damaging 1.00
PIT4453001:Ephb2 UTSW 4 136,388,121 (GRCm39) missense probably benign 0.00
R0004:Ephb2 UTSW 4 136,384,835 (GRCm39) missense probably damaging 1.00
R0121:Ephb2 UTSW 4 136,498,368 (GRCm39) missense probably damaging 0.99
R0539:Ephb2 UTSW 4 136,383,287 (GRCm39) missense probably damaging 1.00
R0614:Ephb2 UTSW 4 136,400,676 (GRCm39) missense probably benign 0.00
R0988:Ephb2 UTSW 4 136,387,019 (GRCm39) missense possibly damaging 0.59
R1471:Ephb2 UTSW 4 136,386,262 (GRCm39) missense probably benign 0.04
R1473:Ephb2 UTSW 4 136,421,369 (GRCm39) missense possibly damaging 0.83
R1546:Ephb2 UTSW 4 136,498,320 (GRCm39) missense probably damaging 0.99
R1639:Ephb2 UTSW 4 136,421,216 (GRCm39) missense probably benign 0.10
R1725:Ephb2 UTSW 4 136,387,089 (GRCm39) nonsense probably null
R1779:Ephb2 UTSW 4 136,421,136 (GRCm39) missense possibly damaging 0.64
R1818:Ephb2 UTSW 4 136,382,647 (GRCm39) missense probably benign 0.02
R2099:Ephb2 UTSW 4 136,388,066 (GRCm39) missense probably damaging 1.00
R2916:Ephb2 UTSW 4 136,411,256 (GRCm39) missense probably damaging 0.99
R3885:Ephb2 UTSW 4 136,498,345 (GRCm39) missense probably damaging 1.00
R4572:Ephb2 UTSW 4 136,383,251 (GRCm39) missense probably damaging 1.00
R4709:Ephb2 UTSW 4 136,423,363 (GRCm39) missense probably damaging 1.00
R4893:Ephb2 UTSW 4 136,387,064 (GRCm39) missense probably damaging 0.99
R4981:Ephb2 UTSW 4 136,423,321 (GRCm39) missense probably benign 0.09
R4992:Ephb2 UTSW 4 136,388,150 (GRCm39) missense probably damaging 1.00
R5004:Ephb2 UTSW 4 136,387,010 (GRCm39) missense possibly damaging 0.77
R5307:Ephb2 UTSW 4 136,421,098 (GRCm39) missense possibly damaging 0.89
R5370:Ephb2 UTSW 4 136,498,881 (GRCm39) missense probably benign 0.00
R5561:Ephb2 UTSW 4 136,388,717 (GRCm39) missense probably damaging 1.00
R5643:Ephb2 UTSW 4 136,498,923 (GRCm39) missense probably damaging 0.99
R5826:Ephb2 UTSW 4 136,388,048 (GRCm39) missense probably damaging 1.00
R5858:Ephb2 UTSW 4 136,399,756 (GRCm39) missense probably benign
R5867:Ephb2 UTSW 4 136,402,733 (GRCm39) missense possibly damaging 0.81
R5990:Ephb2 UTSW 4 136,423,366 (GRCm39) missense probably benign 0.03
R6000:Ephb2 UTSW 4 136,411,341 (GRCm39) missense possibly damaging 0.76
R6156:Ephb2 UTSW 4 136,388,816 (GRCm39) missense probably benign 0.44
R6413:Ephb2 UTSW 4 136,498,433 (GRCm39) missense probably benign 0.08
R6577:Ephb2 UTSW 4 136,384,861 (GRCm39) missense probably damaging 0.99
R6633:Ephb2 UTSW 4 136,411,307 (GRCm39) missense probably benign 0.07
R6720:Ephb2 UTSW 4 136,384,813 (GRCm39) missense probably damaging 0.99
R6795:Ephb2 UTSW 4 136,400,646 (GRCm39) missense possibly damaging 0.88
R7235:Ephb2 UTSW 4 136,421,139 (GRCm39) missense probably damaging 1.00
R7260:Ephb2 UTSW 4 136,498,885 (GRCm39) missense probably damaging 0.96
R7328:Ephb2 UTSW 4 136,386,245 (GRCm39) critical splice donor site probably null
R7404:Ephb2 UTSW 4 136,498,524 (GRCm39) missense probably damaging 1.00
R7466:Ephb2 UTSW 4 136,386,376 (GRCm39) missense probably damaging 1.00
R7524:Ephb2 UTSW 4 136,387,020 (GRCm39) missense probably damaging 1.00
R7605:Ephb2 UTSW 4 136,498,419 (GRCm39) missense probably damaging 1.00
R7611:Ephb2 UTSW 4 136,388,212 (GRCm39) critical splice acceptor site probably null
R7777:Ephb2 UTSW 4 136,498,947 (GRCm39) missense possibly damaging 0.92
R7889:Ephb2 UTSW 4 136,498,353 (GRCm39) missense probably damaging 0.99
R7929:Ephb2 UTSW 4 136,388,195 (GRCm39) missense probably damaging 1.00
R8191:Ephb2 UTSW 4 136,386,256 (GRCm39) missense probably damaging 0.96
R8370:Ephb2 UTSW 4 136,383,302 (GRCm39) missense possibly damaging 0.95
R8444:Ephb2 UTSW 4 136,388,711 (GRCm39) missense probably damaging 1.00
R8724:Ephb2 UTSW 4 136,498,368 (GRCm39) missense probably damaging 0.99
R8988:Ephb2 UTSW 4 136,402,769 (GRCm39) missense probably benign 0.42
R9722:Ephb2 UTSW 4 136,384,768 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGTTCTCTGTGTGTCCC -3'
(R):5'- CTTCTCTGAGATTGCCAGGC -3'

Sequencing Primer
(F):5'- GTGTGTCCCTTCCTGTCTTCAG -3'
(R):5'- CCATTGTAAAAAGGTCCAGAGCTCTG -3'
Posted On 2022-05-16