Incidental Mutation 'R9410:Stag3'
ID 711746
Institutional Source Beutler Lab
Gene Symbol Stag3
Ensembl Gene ENSMUSG00000036928
Gene Name STAG3 cohesin complex component
Synonyms SA-2, stromalin 3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 138278502-138310655 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 138297601 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 606 (F606L)
Ref Sequence ENSEMBL: ENSMUSP00000040945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048028] [ENSMUST00000162245]
AlphaFold O70576
Predicted Effect possibly damaging
Transcript: ENSMUST00000048028
AA Change: F606L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040945
Gene: ENSMUSG00000036928
AA Change: F606L

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 188 301 3.1e-38 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162245
AA Change: F606L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125523
Gene: ENSMUSG00000036928
AA Change: F606L

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 185 304 4e-50 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in the nucleus and is a subunit of the cohesin complex which regulates the cohesion of sister chromatids during cell division. A mutation in this gene is associated with premature ovarian failure. Alternate splicing results in multiple transcript variants encoding distinct isoforms. This gene has multiple pseudogenes. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit azoospermia and lack oocytes. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(1) Transgenic(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,869,703 (GRCm39) S772L probably benign Het
Ampd2 A T 3: 107,982,590 (GRCm39) V722E probably damaging Het
Appbp2 A T 11: 85,106,067 (GRCm39) F83Y probably damaging Het
Arih2 C G 9: 108,488,938 (GRCm39) R260P probably damaging Het
B020004C17Rik A T 14: 57,254,273 (GRCm39) Y132F possibly damaging Het
Cnr1 A G 4: 33,944,973 (GRCm39) T454A possibly damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Ctla4 A T 1: 60,951,911 (GRCm39) T147S probably damaging Het
Ctsa T C 2: 164,677,101 (GRCm39) L152P probably damaging Het
Dgkh T C 14: 78,862,293 (GRCm39) T225A probably damaging Het
Dsg1a A T 18: 20,464,590 (GRCm39) I362F possibly damaging Het
Dzank1 C T 2: 144,324,050 (GRCm39) probably null Het
Ephb2 A T 4: 136,386,948 (GRCm39) C760S probably null Het
Exoc1 T A 5: 76,706,989 (GRCm39) V512E probably benign Het
Faiml C A 9: 99,111,587 (GRCm39) K157N probably benign Het
Fpr2 C T 17: 18,113,604 (GRCm39) T200I probably benign Het
Fscn3 C T 6: 28,430,432 (GRCm39) R201* probably null Het
Hcrtr1 A T 4: 130,029,514 (GRCm39) L189Q probably damaging Het
Igkv4-62 T C 6: 69,376,832 (GRCm39) T84A probably benign Het
Krtap2-4 C A 11: 99,505,437 (GRCm39) R58L possibly damaging Het
Meis1 C T 11: 18,833,987 (GRCm39) probably null Het
Mfsd2b T A 12: 4,915,747 (GRCm39) I422F probably damaging Het
Mre11a G A 9: 14,716,716 (GRCm39) V304M probably damaging Het
Myo5a A G 9: 75,023,496 (GRCm39) E19G probably damaging Het
Ndufa10 A T 1: 92,367,614 (GRCm39) Y339N probably damaging Het
Odad1 T C 7: 45,597,821 (GRCm39) V577A probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,481,663 (GRCm39) probably null Het
Pcdh18 G A 3: 49,699,615 (GRCm39) P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Plin4 A G 17: 56,413,995 (GRCm39) V210A probably benign Het
Rnf150 T C 8: 83,762,722 (GRCm39) M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,386,781 (GRCm39) probably benign Het
Ruvbl2 G A 7: 45,071,618 (GRCm39) Q422* probably null Het
Shroom1 C T 11: 53,354,217 (GRCm39) R46C probably damaging Het
Slc22a2 T C 17: 12,805,732 (GRCm39) F161S probably damaging Het
Src T A 2: 157,311,676 (GRCm39) M468K probably damaging Het
Stau1 T C 2: 166,797,038 (GRCm39) T120A probably benign Het
Sulf2 A C 2: 165,936,444 (GRCm39) L174R Het
Sumf1 A C 6: 108,150,363 (GRCm39) F156C probably damaging Het
Tenm2 T A 11: 36,032,396 (GRCm39) D708V probably damaging Het
Tmprss12 A C 15: 100,190,622 (GRCm39) I331L possibly damaging Het
Tnfrsf10b T G 14: 70,010,849 (GRCm39) C85G probably damaging Het
Trav10d C A 14: 53,048,845 (GRCm39) Q79K probably benign Het
Vmn1r236 T A 17: 21,507,756 (GRCm39) Y291* probably null Het
Vmn2r115 T C 17: 23,578,915 (GRCm39) I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 (GRCm39) H348Q possibly damaging Het
Zfp563 T A 17: 33,321,320 (GRCm39) L40Q probably damaging Het
Other mutations in Stag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Stag3 APN 5 138,297,400 (GRCm39) missense probably damaging 1.00
IGL00336:Stag3 APN 5 138,295,921 (GRCm39) missense probably benign 0.42
IGL00514:Stag3 APN 5 138,298,397 (GRCm39) missense probably damaging 1.00
IGL00961:Stag3 APN 5 138,296,611 (GRCm39) missense probably benign 0.01
IGL01923:Stag3 APN 5 138,287,492 (GRCm39) missense probably damaging 1.00
IGL02252:Stag3 APN 5 138,300,810 (GRCm39) missense probably damaging 1.00
IGL02424:Stag3 APN 5 138,289,628 (GRCm39) missense probably damaging 1.00
IGL02424:Stag3 APN 5 138,280,247 (GRCm39) nonsense probably null
IGL02869:Stag3 APN 5 138,280,955 (GRCm39) missense probably damaging 0.96
thor UTSW 5 138,299,298 (GRCm39) critical splice donor site probably null
R0016:Stag3 UTSW 5 138,289,643 (GRCm39) missense possibly damaging 0.50
R0038:Stag3 UTSW 5 138,299,298 (GRCm39) critical splice donor site probably null
R0038:Stag3 UTSW 5 138,299,298 (GRCm39) critical splice donor site probably null
R0046:Stag3 UTSW 5 138,281,285 (GRCm39) splice site probably benign
R0046:Stag3 UTSW 5 138,281,285 (GRCm39) splice site probably benign
R1455:Stag3 UTSW 5 138,309,997 (GRCm39) missense probably benign 0.00
R1512:Stag3 UTSW 5 138,296,247 (GRCm39) missense probably benign 0.32
R1530:Stag3 UTSW 5 138,295,674 (GRCm39) missense probably damaging 0.99
R1608:Stag3 UTSW 5 138,296,901 (GRCm39) splice site probably null
R1736:Stag3 UTSW 5 138,302,771 (GRCm39) splice site probably benign
R1969:Stag3 UTSW 5 138,298,400 (GRCm39) missense probably damaging 0.99
R2034:Stag3 UTSW 5 138,296,263 (GRCm39) missense possibly damaging 0.82
R2214:Stag3 UTSW 5 138,299,528 (GRCm39) missense possibly damaging 0.92
R2281:Stag3 UTSW 5 138,296,546 (GRCm39) missense probably damaging 1.00
R2411:Stag3 UTSW 5 138,281,290 (GRCm39) splice site probably benign
R3792:Stag3 UTSW 5 138,296,611 (GRCm39) missense probably benign 0.01
R3887:Stag3 UTSW 5 138,297,101 (GRCm39) missense probably damaging 0.99
R4255:Stag3 UTSW 5 138,289,143 (GRCm39) missense probably damaging 0.98
R4777:Stag3 UTSW 5 138,307,461 (GRCm39) unclassified probably benign
R4842:Stag3 UTSW 5 138,307,627 (GRCm39) splice site probably null
R4854:Stag3 UTSW 5 138,294,956 (GRCm39) splice site probably null
R5045:Stag3 UTSW 5 138,302,740 (GRCm39) missense probably damaging 1.00
R5631:Stag3 UTSW 5 138,294,139 (GRCm39) missense probably damaging 0.96
R5729:Stag3 UTSW 5 138,288,485 (GRCm39) missense possibly damaging 0.76
R5894:Stag3 UTSW 5 138,297,100 (GRCm39) missense probably damaging 0.99
R6004:Stag3 UTSW 5 138,287,468 (GRCm39) missense probably damaging 1.00
R6172:Stag3 UTSW 5 138,298,105 (GRCm39) missense probably benign 0.41
R6503:Stag3 UTSW 5 138,302,682 (GRCm39) missense probably damaging 0.96
R6545:Stag3 UTSW 5 138,296,614 (GRCm39) missense possibly damaging 0.84
R6736:Stag3 UTSW 5 138,299,761 (GRCm39) missense probably damaging 0.98
R6861:Stag3 UTSW 5 138,302,969 (GRCm39) missense possibly damaging 0.55
R7012:Stag3 UTSW 5 138,295,871 (GRCm39) splice site probably null
R7358:Stag3 UTSW 5 138,299,770 (GRCm39) missense probably damaging 1.00
R7378:Stag3 UTSW 5 138,280,222 (GRCm39) missense probably benign 0.00
R7392:Stag3 UTSW 5 138,289,628 (GRCm39) missense probably damaging 1.00
R7395:Stag3 UTSW 5 138,280,207 (GRCm39) missense probably benign 0.33
R7818:Stag3 UTSW 5 138,299,705 (GRCm39) missense probably benign 0.00
R8017:Stag3 UTSW 5 138,299,465 (GRCm39) missense possibly damaging 0.80
R8019:Stag3 UTSW 5 138,299,465 (GRCm39) missense possibly damaging 0.80
R8076:Stag3 UTSW 5 138,281,404 (GRCm39) missense probably damaging 0.96
R8393:Stag3 UTSW 5 138,295,017 (GRCm39) missense probably damaging 0.98
R8405:Stag3 UTSW 5 138,302,914 (GRCm39) missense probably damaging 0.99
R8417:Stag3 UTSW 5 138,306,850 (GRCm39) missense probably benign
R8734:Stag3 UTSW 5 138,310,050 (GRCm39) missense probably benign 0.36
R8848:Stag3 UTSW 5 138,288,528 (GRCm39) missense probably null 0.97
R8966:Stag3 UTSW 5 138,289,666 (GRCm39) missense probably damaging 0.99
R9029:Stag3 UTSW 5 138,296,296 (GRCm39) missense probably damaging 1.00
R9292:Stag3 UTSW 5 138,299,712 (GRCm39) missense probably benign 0.01
R9645:Stag3 UTSW 5 138,299,701 (GRCm39) missense possibly damaging 0.78
R9723:Stag3 UTSW 5 138,298,103 (GRCm39) missense probably benign
Z1177:Stag3 UTSW 5 138,299,554 (GRCm39) missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- GGCCAAAGAACGCAAGCTTC -3'
(R):5'- CATAAACCATGGGCCTTGTGG -3'

Sequencing Primer
(F):5'- GCAAGCTTCAAGCCTATGATAAG -3'
(R):5'- CCATGGGCCTTGTGGAAAAC -3'
Posted On 2022-05-16