Incidental Mutation 'R9410:Odad1'
ID 711752
Institutional Source Beutler Lab
Gene Symbol Odad1
Ensembl Gene ENSMUSG00000040189
Gene Name outer dynein arm docking complex subunit 1
Synonyms Ccdc114
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 45573496-45598387 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45597821 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 577 (V577A)
Ref Sequence ENSEMBL: ENSMUSP00000042772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038720] [ENSMUST00000210867]
AlphaFold Q3UX62
Predicted Effect probably benign
Transcript: ENSMUST00000038720
AA Change: V577A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042772
Gene: ENSMUSG00000040189
AA Change: V577A

DomainStartEndE-ValueType
coiled coil region 11 94 N/A INTRINSIC
coiled coil region 137 156 N/A INTRINSIC
low complexity region 174 185 N/A INTRINSIC
coiled coil region 195 229 N/A INTRINSIC
coiled coil region 303 380 N/A INTRINSIC
low complexity region 434 445 N/A INTRINSIC
low complexity region 504 519 N/A INTRINSIC
low complexity region 558 588 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 621 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210867
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that is a component of the outer dynein arm docking complex in cilia cells. Mutations in this gene may cause primary ciliary dyskinesia 20. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,869,703 (GRCm39) S772L probably benign Het
Ampd2 A T 3: 107,982,590 (GRCm39) V722E probably damaging Het
Appbp2 A T 11: 85,106,067 (GRCm39) F83Y probably damaging Het
Arih2 C G 9: 108,488,938 (GRCm39) R260P probably damaging Het
B020004C17Rik A T 14: 57,254,273 (GRCm39) Y132F possibly damaging Het
Cnr1 A G 4: 33,944,973 (GRCm39) T454A possibly damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Ctla4 A T 1: 60,951,911 (GRCm39) T147S probably damaging Het
Ctsa T C 2: 164,677,101 (GRCm39) L152P probably damaging Het
Dgkh T C 14: 78,862,293 (GRCm39) T225A probably damaging Het
Dsg1a A T 18: 20,464,590 (GRCm39) I362F possibly damaging Het
Dzank1 C T 2: 144,324,050 (GRCm39) probably null Het
Ephb2 A T 4: 136,386,948 (GRCm39) C760S probably null Het
Exoc1 T A 5: 76,706,989 (GRCm39) V512E probably benign Het
Faiml C A 9: 99,111,587 (GRCm39) K157N probably benign Het
Fpr2 C T 17: 18,113,604 (GRCm39) T200I probably benign Het
Fscn3 C T 6: 28,430,432 (GRCm39) R201* probably null Het
Hcrtr1 A T 4: 130,029,514 (GRCm39) L189Q probably damaging Het
Igkv4-62 T C 6: 69,376,832 (GRCm39) T84A probably benign Het
Krtap2-4 C A 11: 99,505,437 (GRCm39) R58L possibly damaging Het
Meis1 C T 11: 18,833,987 (GRCm39) probably null Het
Mfsd2b T A 12: 4,915,747 (GRCm39) I422F probably damaging Het
Mre11a G A 9: 14,716,716 (GRCm39) V304M probably damaging Het
Myo5a A G 9: 75,023,496 (GRCm39) E19G probably damaging Het
Ndufa10 A T 1: 92,367,614 (GRCm39) Y339N probably damaging Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,481,663 (GRCm39) probably null Het
Pcdh18 G A 3: 49,699,615 (GRCm39) P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Plin4 A G 17: 56,413,995 (GRCm39) V210A probably benign Het
Rnf150 T C 8: 83,762,722 (GRCm39) M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,386,781 (GRCm39) probably benign Het
Ruvbl2 G A 7: 45,071,618 (GRCm39) Q422* probably null Het
Shroom1 C T 11: 53,354,217 (GRCm39) R46C probably damaging Het
Slc22a2 T C 17: 12,805,732 (GRCm39) F161S probably damaging Het
Src T A 2: 157,311,676 (GRCm39) M468K probably damaging Het
Stag3 T C 5: 138,297,601 (GRCm39) F606L possibly damaging Het
Stau1 T C 2: 166,797,038 (GRCm39) T120A probably benign Het
Sulf2 A C 2: 165,936,444 (GRCm39) L174R Het
Sumf1 A C 6: 108,150,363 (GRCm39) F156C probably damaging Het
Tenm2 T A 11: 36,032,396 (GRCm39) D708V probably damaging Het
Tmprss12 A C 15: 100,190,622 (GRCm39) I331L possibly damaging Het
Tnfrsf10b T G 14: 70,010,849 (GRCm39) C85G probably damaging Het
Trav10d C A 14: 53,048,845 (GRCm39) Q79K probably benign Het
Vmn1r236 T A 17: 21,507,756 (GRCm39) Y291* probably null Het
Vmn2r115 T C 17: 23,578,915 (GRCm39) I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 (GRCm39) H348Q possibly damaging Het
Zfp563 T A 17: 33,321,320 (GRCm39) L40Q probably damaging Het
Other mutations in Odad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Odad1 APN 7 45,592,080 (GRCm39) missense probably damaging 1.00
IGL01383:Odad1 APN 7 45,589,124 (GRCm39) missense probably damaging 1.00
IGL01826:Odad1 APN 7 45,597,810 (GRCm39) missense possibly damaging 0.62
R0865:Odad1 UTSW 7 45,591,512 (GRCm39) missense probably benign 0.17
R1061:Odad1 UTSW 7 45,591,179 (GRCm39) missense probably damaging 0.96
R1217:Odad1 UTSW 7 45,592,182 (GRCm39) splice site probably benign
R1533:Odad1 UTSW 7 45,592,282 (GRCm39) missense probably benign 0.00
R2863:Odad1 UTSW 7 45,597,736 (GRCm39) missense probably benign 0.04
R3954:Odad1 UTSW 7 45,591,100 (GRCm39) missense probably damaging 1.00
R4774:Odad1 UTSW 7 45,597,804 (GRCm39) missense probably damaging 0.99
R4861:Odad1 UTSW 7 45,592,297 (GRCm39) missense probably damaging 0.98
R4861:Odad1 UTSW 7 45,592,297 (GRCm39) missense probably damaging 0.98
R4952:Odad1 UTSW 7 45,591,615 (GRCm39) missense probably damaging 1.00
R5074:Odad1 UTSW 7 45,578,514 (GRCm39) missense probably benign 0.05
R5187:Odad1 UTSW 7 45,578,540 (GRCm39) missense probably damaging 1.00
R5265:Odad1 UTSW 7 45,596,859 (GRCm39) missense probably damaging 1.00
R5364:Odad1 UTSW 7 45,585,756 (GRCm39) missense probably damaging 0.99
R5377:Odad1 UTSW 7 45,591,506 (GRCm39) nonsense probably null
R6221:Odad1 UTSW 7 45,596,903 (GRCm39) missense probably damaging 1.00
R6246:Odad1 UTSW 7 45,585,788 (GRCm39) missense probably damaging 1.00
R6324:Odad1 UTSW 7 45,591,134 (GRCm39) missense probably damaging 1.00
R6389:Odad1 UTSW 7 45,597,940 (GRCm39) missense probably benign 0.32
R6542:Odad1 UTSW 7 45,597,814 (GRCm39) missense probably benign 0.00
R6593:Odad1 UTSW 7 45,596,808 (GRCm39) missense probably damaging 0.96
R7215:Odad1 UTSW 7 45,586,046 (GRCm39) missense probably damaging 1.00
R7401:Odad1 UTSW 7 45,592,189 (GRCm39) missense probably damaging 1.00
R7431:Odad1 UTSW 7 45,578,670 (GRCm39) missense probably damaging 0.99
R7725:Odad1 UTSW 7 45,597,835 (GRCm39) missense probably damaging 0.98
R7878:Odad1 UTSW 7 45,573,984 (GRCm39) missense possibly damaging 0.91
R8036:Odad1 UTSW 7 45,592,276 (GRCm39) missense probably benign 0.06
R8681:Odad1 UTSW 7 45,591,263 (GRCm39) missense probably damaging 0.96
R8686:Odad1 UTSW 7 45,597,116 (GRCm39) missense probably benign 0.20
R9016:Odad1 UTSW 7 45,585,988 (GRCm39) missense probably damaging 1.00
R9093:Odad1 UTSW 7 45,596,965 (GRCm39) missense possibly damaging 0.53
R9254:Odad1 UTSW 7 45,597,116 (GRCm39) missense probably benign 0.20
R9379:Odad1 UTSW 7 45,597,116 (GRCm39) missense probably benign 0.20
R9713:Odad1 UTSW 7 45,578,562 (GRCm39) missense probably damaging 0.96
X0064:Odad1 UTSW 7 45,597,817 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTCACTGTCCCCAAGCATTC -3'
(R):5'- CTGGAGTCCTTGCTAGTAGAGG -3'

Sequencing Primer
(F):5'- TTCCAAGAAGACCAGTGTAGTC -3'
(R):5'- ACTGGATGCATGGCCACTG -3'
Posted On 2022-05-16