Incidental Mutation 'R9410:Rnf150'
ID 711753
Institutional Source Beutler Lab
Gene Symbol Rnf150
Ensembl Gene ENSMUSG00000047747
Gene Name ring finger protein 150
Synonyms Greul5, A630007N06Rik, C030044C12Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.496) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 83589985-83817897 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83762722 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 319 (M319T)
Ref Sequence ENSEMBL: ENSMUSP00000077610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078525]
AlphaFold Q5DTZ6
Predicted Effect possibly damaging
Transcript: ENSMUST00000078525
AA Change: M319T

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077610
Gene: ENSMUSG00000047747
AA Change: M319T

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
Pfam:PA 84 180 2.1e-12 PFAM
transmembrane domain 207 229 N/A INTRINSIC
RING 277 317 1.29e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,869,703 (GRCm39) S772L probably benign Het
Ampd2 A T 3: 107,982,590 (GRCm39) V722E probably damaging Het
Appbp2 A T 11: 85,106,067 (GRCm39) F83Y probably damaging Het
Arih2 C G 9: 108,488,938 (GRCm39) R260P probably damaging Het
B020004C17Rik A T 14: 57,254,273 (GRCm39) Y132F possibly damaging Het
Cnr1 A G 4: 33,944,973 (GRCm39) T454A possibly damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Ctla4 A T 1: 60,951,911 (GRCm39) T147S probably damaging Het
Ctsa T C 2: 164,677,101 (GRCm39) L152P probably damaging Het
Dgkh T C 14: 78,862,293 (GRCm39) T225A probably damaging Het
Dsg1a A T 18: 20,464,590 (GRCm39) I362F possibly damaging Het
Dzank1 C T 2: 144,324,050 (GRCm39) probably null Het
Ephb2 A T 4: 136,386,948 (GRCm39) C760S probably null Het
Exoc1 T A 5: 76,706,989 (GRCm39) V512E probably benign Het
Faiml C A 9: 99,111,587 (GRCm39) K157N probably benign Het
Fpr2 C T 17: 18,113,604 (GRCm39) T200I probably benign Het
Fscn3 C T 6: 28,430,432 (GRCm39) R201* probably null Het
Hcrtr1 A T 4: 130,029,514 (GRCm39) L189Q probably damaging Het
Igkv4-62 T C 6: 69,376,832 (GRCm39) T84A probably benign Het
Krtap2-4 C A 11: 99,505,437 (GRCm39) R58L possibly damaging Het
Meis1 C T 11: 18,833,987 (GRCm39) probably null Het
Mfsd2b T A 12: 4,915,747 (GRCm39) I422F probably damaging Het
Mre11a G A 9: 14,716,716 (GRCm39) V304M probably damaging Het
Myo5a A G 9: 75,023,496 (GRCm39) E19G probably damaging Het
Ndufa10 A T 1: 92,367,614 (GRCm39) Y339N probably damaging Het
Odad1 T C 7: 45,597,821 (GRCm39) V577A probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,481,663 (GRCm39) probably null Het
Pcdh18 G A 3: 49,699,615 (GRCm39) P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Plin4 A G 17: 56,413,995 (GRCm39) V210A probably benign Het
Rnf180 CGAGG CGAGGAGG 13: 105,386,781 (GRCm39) probably benign Het
Ruvbl2 G A 7: 45,071,618 (GRCm39) Q422* probably null Het
Shroom1 C T 11: 53,354,217 (GRCm39) R46C probably damaging Het
Slc22a2 T C 17: 12,805,732 (GRCm39) F161S probably damaging Het
Src T A 2: 157,311,676 (GRCm39) M468K probably damaging Het
Stag3 T C 5: 138,297,601 (GRCm39) F606L possibly damaging Het
Stau1 T C 2: 166,797,038 (GRCm39) T120A probably benign Het
Sulf2 A C 2: 165,936,444 (GRCm39) L174R Het
Sumf1 A C 6: 108,150,363 (GRCm39) F156C probably damaging Het
Tenm2 T A 11: 36,032,396 (GRCm39) D708V probably damaging Het
Tmprss12 A C 15: 100,190,622 (GRCm39) I331L possibly damaging Het
Tnfrsf10b T G 14: 70,010,849 (GRCm39) C85G probably damaging Het
Trav10d C A 14: 53,048,845 (GRCm39) Q79K probably benign Het
Vmn1r236 T A 17: 21,507,756 (GRCm39) Y291* probably null Het
Vmn2r115 T C 17: 23,578,915 (GRCm39) I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 (GRCm39) H348Q possibly damaging Het
Zfp563 T A 17: 33,321,320 (GRCm39) L40Q probably damaging Het
Other mutations in Rnf150
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Rnf150 APN 8 83,730,234 (GRCm39) missense probably damaging 0.96
R0512:Rnf150 UTSW 8 83,590,807 (GRCm39) missense probably benign 0.01
R1848:Rnf150 UTSW 8 83,590,639 (GRCm39) start codon destroyed possibly damaging 0.67
R2078:Rnf150 UTSW 8 83,730,234 (GRCm39) missense probably damaging 0.96
R2192:Rnf150 UTSW 8 83,591,020 (GRCm39) missense probably damaging 0.98
R3918:Rnf150 UTSW 8 83,591,090 (GRCm39) missense probably benign 0.25
R4365:Rnf150 UTSW 8 83,590,744 (GRCm39) missense probably benign 0.05
R4781:Rnf150 UTSW 8 83,590,781 (GRCm39) missense probably damaging 1.00
R4810:Rnf150 UTSW 8 83,716,991 (GRCm39) missense possibly damaging 0.66
R4859:Rnf150 UTSW 8 83,590,712 (GRCm39) missense probably damaging 1.00
R5677:Rnf150 UTSW 8 83,730,228 (GRCm39) nonsense probably null
R6022:Rnf150 UTSW 8 83,769,358 (GRCm39) missense probably benign 0.00
R6241:Rnf150 UTSW 8 83,591,093 (GRCm39) missense possibly damaging 0.82
R6283:Rnf150 UTSW 8 83,717,183 (GRCm39) missense probably damaging 1.00
R6306:Rnf150 UTSW 8 83,810,131 (GRCm39) missense possibly damaging 0.90
R7014:Rnf150 UTSW 8 83,769,292 (GRCm39) missense probably benign
R7023:Rnf150 UTSW 8 83,590,706 (GRCm39) missense probably damaging 0.97
R7394:Rnf150 UTSW 8 83,717,100 (GRCm39) nonsense probably null
R7710:Rnf150 UTSW 8 83,590,781 (GRCm39) missense probably damaging 1.00
R7771:Rnf150 UTSW 8 83,590,832 (GRCm39) missense probably benign 0.00
R8073:Rnf150 UTSW 8 83,590,546 (GRCm39) start gained probably benign
R8856:Rnf150 UTSW 8 83,762,715 (GRCm39) missense probably damaging 1.00
R8980:Rnf150 UTSW 8 83,717,087 (GRCm39) missense probably benign 0.19
R9139:Rnf150 UTSW 8 83,590,588 (GRCm39) start gained probably benign
R9289:Rnf150 UTSW 8 83,716,982 (GRCm39) missense probably benign
R9594:Rnf150 UTSW 8 83,717,144 (GRCm39) missense probably damaging 1.00
R9603:Rnf150 UTSW 8 83,717,208 (GRCm39) missense possibly damaging 0.64
R9763:Rnf150 UTSW 8 83,732,968 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTCTGCCATGCATCAGTC -3'
(R):5'- CCTTCCTTTACTCAGACAAATGGTG -3'

Sequencing Primer
(F):5'- ATGCATCAGTCGAGGGACCTTG -3'
(R):5'- CTTTACTCAGACAAATGGTGGGCATG -3'
Posted On 2022-05-16