Incidental Mutation 'R9410:Mre11a'
ID 711754
Institutional Source Beutler Lab
Gene Symbol Mre11a
Ensembl Gene ENSMUSG00000031928
Gene Name MRE11A homolog A, double strand break repair nuclease
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 14784654-14837123 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 14805420 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 304 (V304M)
Ref Sequence ENSEMBL: ENSMUSP00000034405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034405] [ENSMUST00000115632]
AlphaFold Q61216
Predicted Effect probably damaging
Transcript: ENSMUST00000034405
AA Change: V304M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034405
Gene: ENSMUSG00000031928
AA Change: V304M

DomainStartEndE-ValueType
Pfam:Metallophos 13 249 6.3e-15 PFAM
Mre11_DNA_bind 294 462 1.72e-70 SMART
coiled coil region 487 519 N/A INTRINSIC
low complexity region 566 594 N/A INTRINSIC
low complexity region 683 699 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115632
AA Change: V304M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111295
Gene: ENSMUSG00000031928
AA Change: V304M

DomainStartEndE-ValueType
Pfam:Metallophos 13 249 1.1e-31 PFAM
Mre11_DNA_bind 294 435 7.6e-49 SMART
coiled coil region 460 492 N/A INTRINSIC
low complexity region 539 567 N/A INTRINSIC
low complexity region 656 672 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000119999
Gene: ENSMUSG00000031928
AA Change: V71M

DomainStartEndE-ValueType
PDB:3T1I|D 2 50 3e-26 PDB
Mre11_DNA_bind 62 170 1.81e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein involved in homologous recombination, telomere length maintenance, and DNA double-strand break repair. By itself, the protein has 3' to 5' exonuclease activity and endonuclease activity. The protein forms a complex with the RAD50 homolog; this complex is required for nonhomologous joining of DNA ends and possesses increased single-stranded DNA endonuclease and 3' to 5' exonuclease activities. In conjunction with a DNA ligase, this protein promotes the joining of noncomplementary ends in vitro using short homologies near the ends of the DNA fragments. This gene has a pseudogene on chromosome 3. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Though mutation of this locus affected chromosome stability, mutant mice were no more susceptible to tumorigenesis than wild-type mice. Mutant female mice showed reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,905,968 S772L probably benign Het
Ampd2 A T 3: 108,075,274 V722E probably damaging Het
Appbp2 A T 11: 85,215,241 F83Y probably damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
B020004C17Rik A T 14: 57,016,816 Y132F possibly damaging Het
Ccdc114 T C 7: 45,948,397 V577A probably benign Het
Cnr1 A G 4: 33,944,973 T454A possibly damaging Het
Creb3l1 C T 2: 91,991,886 probably null Het
Ctla4 A T 1: 60,912,752 T147S probably damaging Het
Ctsa T C 2: 164,835,181 L152P probably damaging Het
Dgkh T C 14: 78,624,853 T225A probably damaging Het
Dsg1a A T 18: 20,331,533 I362F possibly damaging Het
Dzank1 C T 2: 144,482,130 probably null Het
Ephb2 A T 4: 136,659,637 C760S probably null Het
Exoc1 T A 5: 76,559,142 V512E probably benign Het
Faiml C A 9: 99,229,534 K157N probably benign Het
Fpr2 C T 17: 17,893,342 T200I probably benign Het
Fscn3 C T 6: 28,430,433 R201* probably null Het
Hcrtr1 A T 4: 130,135,721 L189Q probably damaging Het
Igkv4-62 T C 6: 69,399,848 T84A probably benign Het
Krtap2-4 C A 11: 99,614,611 R58L possibly damaging Het
Meis1 C T 11: 18,883,987 probably null Het
Mfsd2b T A 12: 4,865,747 I422F probably damaging Het
Myo5a A G 9: 75,116,214 E19G probably damaging Het
Ndufa10 A T 1: 92,439,892 Y339N probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,645,831 probably null Het
Pcdh18 G A 3: 49,745,166 P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Plin4 A G 17: 56,106,995 V210A probably benign Het
Rnf150 T C 8: 83,036,093 M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,250,273 probably benign Het
Ruvbl2 G A 7: 45,422,194 Q422* probably null Het
Shroom1 C T 11: 53,463,390 R46C probably damaging Het
Slc22a2 T C 17: 12,586,845 F161S probably damaging Het
Src T A 2: 157,469,756 M468K probably damaging Het
Stag3 T C 5: 138,299,339 F606L possibly damaging Het
Stau1 T C 2: 166,955,118 T120A probably benign Het
Sulf2 A C 2: 166,094,524 L174R Het
Sumf1 A C 6: 108,173,402 F156C probably damaging Het
Tenm2 T A 11: 36,141,569 D708V probably damaging Het
Tmprss12 A C 15: 100,292,741 I331L possibly damaging Het
Tnfrsf10b T G 14: 69,773,400 C85G probably damaging Het
Trav10d C A 14: 52,811,388 Q79K probably benign Het
Vmn1r236 T A 17: 21,287,494 Y291* probably null Het
Vmn2r115 T C 17: 23,359,941 I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 H348Q possibly damaging Het
Zfp563 T A 17: 33,102,346 L40Q probably damaging Het
Other mutations in Mre11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Mre11a APN 9 14825208 missense probably benign 0.28
IGL00429:Mre11a APN 9 14802813 missense probably damaging 1.00
IGL00922:Mre11a APN 9 14799588 missense probably damaging 1.00
IGL01095:Mre11a APN 9 14809824 missense probably benign
IGL01294:Mre11a APN 9 14830915 missense probably damaging 0.97
IGL01871:Mre11a APN 9 14811897 missense possibly damaging 0.95
IGL02194:Mre11a APN 9 14815209 missense possibly damaging 0.70
IGL02213:Mre11a APN 9 14811884 missense probably damaging 1.00
IGL02245:Mre11a APN 9 14815276 unclassified probably benign
IGL02749:Mre11a APN 9 14826591 missense possibly damaging 0.78
IGL02812:Mre11a APN 9 14790670 splice site probably null
bow UTSW 9 14786962 missense probably damaging 1.00
R0050:Mre11a UTSW 9 14830973 splice site probably benign
R0594:Mre11a UTSW 9 14815209 missense probably benign 0.00
R1241:Mre11a UTSW 9 14799639 missense probably damaging 1.00
R1905:Mre11a UTSW 9 14799627 missense probably benign 0.08
R2030:Mre11a UTSW 9 14795805 missense probably damaging 1.00
R2270:Mre11a UTSW 9 14815174 missense probably benign 0.00
R2511:Mre11a UTSW 9 14795769 critical splice acceptor site probably null
R2851:Mre11a UTSW 9 14826547 missense probably benign 0.00
R2852:Mre11a UTSW 9 14826547 missense probably benign 0.00
R2853:Mre11a UTSW 9 14826547 missense probably benign 0.00
R3765:Mre11a UTSW 9 14809847 missense probably benign 0.25
R4612:Mre11a UTSW 9 14802903 missense probably damaging 1.00
R5007:Mre11a UTSW 9 14809820 missense probably benign 0.10
R5343:Mre11a UTSW 9 14811834 missense probably damaging 0.98
R5679:Mre11a UTSW 9 14786919 missense probably damaging 0.99
R5834:Mre11a UTSW 9 14799657 missense probably benign 0.15
R5914:Mre11a UTSW 9 14811936 missense probably damaging 1.00
R5935:Mre11a UTSW 9 14786962 missense probably damaging 1.00
R6089:Mre11a UTSW 9 14819464 missense probably benign 0.02
R6393:Mre11a UTSW 9 14785509 start codon destroyed probably null 0.00
R6625:Mre11a UTSW 9 14805391 missense possibly damaging 0.52
R7248:Mre11a UTSW 9 14811913 missense possibly damaging 0.52
R7744:Mre11a UTSW 9 14809832 missense possibly damaging 0.94
R7999:Mre11a UTSW 9 14799669 nonsense probably null
R8179:Mre11a UTSW 9 14797066 missense probably null 1.00
R9293:Mre11a UTSW 9 14799588 missense probably damaging 1.00
R9302:Mre11a UTSW 9 14785530 critical splice donor site probably null
R9368:Mre11a UTSW 9 14825218 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAGGAGTTCACTTTATTCTTAGGAAG -3'
(R):5'- TACACTGCTCAGCCCTGTAAC -3'

Sequencing Primer
(F):5'- CAGTCTCCTGGGTGTTAGGAATCAC -3'
(R):5'- TAACCGAGGGGCAGTGAGTTTTC -3'
Posted On 2022-05-16