Incidental Mutation 'R9410:Shroom1'
ID 711761
Institutional Source Beutler Lab
Gene Symbol Shroom1
Ensembl Gene ENSMUSG00000018387
Gene Name shroom family member 1
Synonyms 1300007L22Rik, Shrm1, Apx
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.132) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 53348032-53358593 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 53354217 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 46 (R46C)
Ref Sequence ENSEMBL: ENSMUSP00000104641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018531] [ENSMUST00000093114] [ENSMUST00000109013]
AlphaFold Q5SX79
Predicted Effect possibly damaging
Transcript: ENSMUST00000018531
AA Change: R46C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018531
Gene: ENSMUSG00000018387
AA Change: R46C

DomainStartEndE-ValueType
Pfam:ASD1 108 269 1.1e-21 PFAM
low complexity region 410 417 N/A INTRINSIC
Pfam:ASD2 454 732 4.4e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093114
AA Change: R46C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090802
Gene: ENSMUSG00000018387
AA Change: R46C

DomainStartEndE-ValueType
Pfam:ASD1 108 269 3.7e-22 PFAM
low complexity region 473 480 N/A INTRINSIC
Pfam:ASD2 517 715 1e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109013
AA Change: R46C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104641
Gene: ENSMUSG00000018387
AA Change: R46C

DomainStartEndE-ValueType
Pfam:ASD1 114 269 4.2e-19 PFAM
low complexity region 473 480 N/A INTRINSIC
Pfam:ASD2 518 795 2.4e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHROOM family members play diverse roles in the development of the nervous system and other tissues (Hagens et al., 2006 [PubMed 16615870]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,869,703 (GRCm39) S772L probably benign Het
Ampd2 A T 3: 107,982,590 (GRCm39) V722E probably damaging Het
Appbp2 A T 11: 85,106,067 (GRCm39) F83Y probably damaging Het
Arih2 C G 9: 108,488,938 (GRCm39) R260P probably damaging Het
B020004C17Rik A T 14: 57,254,273 (GRCm39) Y132F possibly damaging Het
Cnr1 A G 4: 33,944,973 (GRCm39) T454A possibly damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Ctla4 A T 1: 60,951,911 (GRCm39) T147S probably damaging Het
Ctsa T C 2: 164,677,101 (GRCm39) L152P probably damaging Het
Dgkh T C 14: 78,862,293 (GRCm39) T225A probably damaging Het
Dsg1a A T 18: 20,464,590 (GRCm39) I362F possibly damaging Het
Dzank1 C T 2: 144,324,050 (GRCm39) probably null Het
Ephb2 A T 4: 136,386,948 (GRCm39) C760S probably null Het
Exoc1 T A 5: 76,706,989 (GRCm39) V512E probably benign Het
Faiml C A 9: 99,111,587 (GRCm39) K157N probably benign Het
Fpr2 C T 17: 18,113,604 (GRCm39) T200I probably benign Het
Fscn3 C T 6: 28,430,432 (GRCm39) R201* probably null Het
Hcrtr1 A T 4: 130,029,514 (GRCm39) L189Q probably damaging Het
Igkv4-62 T C 6: 69,376,832 (GRCm39) T84A probably benign Het
Krtap2-4 C A 11: 99,505,437 (GRCm39) R58L possibly damaging Het
Meis1 C T 11: 18,833,987 (GRCm39) probably null Het
Mfsd2b T A 12: 4,915,747 (GRCm39) I422F probably damaging Het
Mre11a G A 9: 14,716,716 (GRCm39) V304M probably damaging Het
Myo5a A G 9: 75,023,496 (GRCm39) E19G probably damaging Het
Ndufa10 A T 1: 92,367,614 (GRCm39) Y339N probably damaging Het
Odad1 T C 7: 45,597,821 (GRCm39) V577A probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,481,663 (GRCm39) probably null Het
Pcdh18 G A 3: 49,699,615 (GRCm39) P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Plin4 A G 17: 56,413,995 (GRCm39) V210A probably benign Het
Rnf150 T C 8: 83,762,722 (GRCm39) M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,386,781 (GRCm39) probably benign Het
Ruvbl2 G A 7: 45,071,618 (GRCm39) Q422* probably null Het
Slc22a2 T C 17: 12,805,732 (GRCm39) F161S probably damaging Het
Src T A 2: 157,311,676 (GRCm39) M468K probably damaging Het
Stag3 T C 5: 138,297,601 (GRCm39) F606L possibly damaging Het
Stau1 T C 2: 166,797,038 (GRCm39) T120A probably benign Het
Sulf2 A C 2: 165,936,444 (GRCm39) L174R Het
Sumf1 A C 6: 108,150,363 (GRCm39) F156C probably damaging Het
Tenm2 T A 11: 36,032,396 (GRCm39) D708V probably damaging Het
Tmprss12 A C 15: 100,190,622 (GRCm39) I331L possibly damaging Het
Tnfrsf10b T G 14: 70,010,849 (GRCm39) C85G probably damaging Het
Trav10d C A 14: 53,048,845 (GRCm39) Q79K probably benign Het
Vmn1r236 T A 17: 21,507,756 (GRCm39) Y291* probably null Het
Vmn2r115 T C 17: 23,578,915 (GRCm39) I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 (GRCm39) H348Q possibly damaging Het
Zfp563 T A 17: 33,321,320 (GRCm39) L40Q probably damaging Het
Other mutations in Shroom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Shroom1 APN 11 53,354,921 (GRCm39) missense probably benign 0.00
IGL00985:Shroom1 APN 11 53,356,796 (GRCm39) missense probably benign
IGL01111:Shroom1 APN 11 53,354,875 (GRCm39) missense probably damaging 0.98
IGL01316:Shroom1 APN 11 53,356,385 (GRCm39) missense probably damaging 0.99
IGL02512:Shroom1 APN 11 53,357,386 (GRCm39) missense probably damaging 1.00
IGL03062:Shroom1 APN 11 53,354,206 (GRCm39) missense probably benign
bracket UTSW 11 53,354,809 (GRCm39) nonsense probably null
shitake UTSW 11 53,356,549 (GRCm39) missense possibly damaging 0.91
R0083:Shroom1 UTSW 11 53,357,764 (GRCm39) missense possibly damaging 0.93
R0108:Shroom1 UTSW 11 53,357,764 (GRCm39) missense possibly damaging 0.93
R0108:Shroom1 UTSW 11 53,357,764 (GRCm39) missense possibly damaging 0.93
R0242:Shroom1 UTSW 11 53,356,312 (GRCm39) splice site probably null
R0242:Shroom1 UTSW 11 53,356,312 (GRCm39) splice site probably null
R0357:Shroom1 UTSW 11 53,356,035 (GRCm39) missense probably damaging 0.96
R0661:Shroom1 UTSW 11 53,357,764 (GRCm39) missense possibly damaging 0.93
R1875:Shroom1 UTSW 11 53,356,502 (GRCm39) missense probably damaging 0.99
R2356:Shroom1 UTSW 11 53,357,274 (GRCm39) missense probably benign 0.05
R4657:Shroom1 UTSW 11 53,356,415 (GRCm39) missense possibly damaging 0.79
R4662:Shroom1 UTSW 11 53,357,289 (GRCm39) missense possibly damaging 0.64
R4690:Shroom1 UTSW 11 53,356,549 (GRCm39) missense possibly damaging 0.91
R4734:Shroom1 UTSW 11 53,356,060 (GRCm39) missense probably damaging 1.00
R4820:Shroom1 UTSW 11 53,355,966 (GRCm39) missense probably benign 0.07
R4964:Shroom1 UTSW 11 53,355,999 (GRCm39) missense probably benign
R5000:Shroom1 UTSW 11 53,357,944 (GRCm39) utr 3 prime probably benign
R5046:Shroom1 UTSW 11 53,354,872 (GRCm39) missense probably benign 0.00
R5141:Shroom1 UTSW 11 53,354,809 (GRCm39) nonsense probably null
R5256:Shroom1 UTSW 11 53,356,334 (GRCm39) missense probably benign 0.32
R5273:Shroom1 UTSW 11 53,354,671 (GRCm39) missense possibly damaging 0.82
R5529:Shroom1 UTSW 11 53,354,749 (GRCm39) missense probably damaging 1.00
R5762:Shroom1 UTSW 11 53,354,818 (GRCm39) missense probably benign 0.00
R6058:Shroom1 UTSW 11 53,354,308 (GRCm39) missense possibly damaging 0.83
R6408:Shroom1 UTSW 11 53,354,214 (GRCm39) missense probably benign 0.00
R6677:Shroom1 UTSW 11 53,354,343 (GRCm39) missense possibly damaging 0.85
R7090:Shroom1 UTSW 11 53,356,760 (GRCm39) missense probably damaging 1.00
R7369:Shroom1 UTSW 11 53,356,075 (GRCm39) missense probably benign 0.43
R7654:Shroom1 UTSW 11 53,357,735 (GRCm39) missense probably benign 0.02
R7919:Shroom1 UTSW 11 53,354,220 (GRCm39) missense probably benign 0.17
R7964:Shroom1 UTSW 11 53,355,149 (GRCm39) missense possibly damaging 0.94
R8338:Shroom1 UTSW 11 53,354,107 (GRCm39) missense probably benign 0.08
R8365:Shroom1 UTSW 11 53,356,468 (GRCm39) nonsense probably null
R8386:Shroom1 UTSW 11 53,357,230 (GRCm39) missense probably damaging 1.00
R8971:Shroom1 UTSW 11 53,355,994 (GRCm39) missense probably damaging 0.99
R9116:Shroom1 UTSW 11 53,354,490 (GRCm39) missense probably damaging 1.00
R9392:Shroom1 UTSW 11 53,354,674 (GRCm39) missense possibly damaging 0.91
R9577:Shroom1 UTSW 11 53,357,612 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTCTGCCAACTCCAATTTCC -3'
(R):5'- TTTCGCTGGAAGGACGTCTC -3'

Sequencing Primer
(F):5'- TTCCAACTGTATAAGCATGGAGGCC -3'
(R):5'- TTAGTGGTCCCGGGCTTCC -3'
Posted On 2022-05-16