Incidental Mutation 'R9410:Appbp2'
ID 711762
Institutional Source Beutler Lab
Gene Symbol Appbp2
Ensembl Gene ENSMUSG00000018481
Gene Name amyloid beta precursor protein binding protein 2
Synonyms 1300003O07Rik, PAT1
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.743) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 85082134-85125946 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 85106067 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 83 (F83Y)
Ref Sequence ENSEMBL: ENSMUSP00000018625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018625]
AlphaFold Q9DAX9
Predicted Effect probably damaging
Transcript: ENSMUST00000018625
AA Change: F83Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018625
Gene: ENSMUSG00000018481
AA Change: F83Y

DomainStartEndE-ValueType
Pfam:TPR_12 395 461 6.5e-13 PFAM
Pfam:TPR_10 428 467 1.1e-9 PFAM
Pfam:TPR_7 432 466 1.2e-5 PFAM
Pfam:TPR_10 470 509 8.9e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with microtubules and is functionally associated with beta-amyloid precursor protein transport and/or processing. The beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. The encoded protein may be involved in regulating cell death. This gene has been found to be highly expressed in breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,869,703 (GRCm39) S772L probably benign Het
Ampd2 A T 3: 107,982,590 (GRCm39) V722E probably damaging Het
Arih2 C G 9: 108,488,938 (GRCm39) R260P probably damaging Het
B020004C17Rik A T 14: 57,254,273 (GRCm39) Y132F possibly damaging Het
Cnr1 A G 4: 33,944,973 (GRCm39) T454A possibly damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Ctla4 A T 1: 60,951,911 (GRCm39) T147S probably damaging Het
Ctsa T C 2: 164,677,101 (GRCm39) L152P probably damaging Het
Dgkh T C 14: 78,862,293 (GRCm39) T225A probably damaging Het
Dsg1a A T 18: 20,464,590 (GRCm39) I362F possibly damaging Het
Dzank1 C T 2: 144,324,050 (GRCm39) probably null Het
Ephb2 A T 4: 136,386,948 (GRCm39) C760S probably null Het
Exoc1 T A 5: 76,706,989 (GRCm39) V512E probably benign Het
Faiml C A 9: 99,111,587 (GRCm39) K157N probably benign Het
Fpr2 C T 17: 18,113,604 (GRCm39) T200I probably benign Het
Fscn3 C T 6: 28,430,432 (GRCm39) R201* probably null Het
Hcrtr1 A T 4: 130,029,514 (GRCm39) L189Q probably damaging Het
Igkv4-62 T C 6: 69,376,832 (GRCm39) T84A probably benign Het
Krtap2-4 C A 11: 99,505,437 (GRCm39) R58L possibly damaging Het
Meis1 C T 11: 18,833,987 (GRCm39) probably null Het
Mfsd2b T A 12: 4,915,747 (GRCm39) I422F probably damaging Het
Mre11a G A 9: 14,716,716 (GRCm39) V304M probably damaging Het
Myo5a A G 9: 75,023,496 (GRCm39) E19G probably damaging Het
Ndufa10 A T 1: 92,367,614 (GRCm39) Y339N probably damaging Het
Odad1 T C 7: 45,597,821 (GRCm39) V577A probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,481,663 (GRCm39) probably null Het
Pcdh18 G A 3: 49,699,615 (GRCm39) P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Plin4 A G 17: 56,413,995 (GRCm39) V210A probably benign Het
Rnf150 T C 8: 83,762,722 (GRCm39) M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,386,781 (GRCm39) probably benign Het
Ruvbl2 G A 7: 45,071,618 (GRCm39) Q422* probably null Het
Shroom1 C T 11: 53,354,217 (GRCm39) R46C probably damaging Het
Slc22a2 T C 17: 12,805,732 (GRCm39) F161S probably damaging Het
Src T A 2: 157,311,676 (GRCm39) M468K probably damaging Het
Stag3 T C 5: 138,297,601 (GRCm39) F606L possibly damaging Het
Stau1 T C 2: 166,797,038 (GRCm39) T120A probably benign Het
Sulf2 A C 2: 165,936,444 (GRCm39) L174R Het
Sumf1 A C 6: 108,150,363 (GRCm39) F156C probably damaging Het
Tenm2 T A 11: 36,032,396 (GRCm39) D708V probably damaging Het
Tmprss12 A C 15: 100,190,622 (GRCm39) I331L possibly damaging Het
Tnfrsf10b T G 14: 70,010,849 (GRCm39) C85G probably damaging Het
Trav10d C A 14: 53,048,845 (GRCm39) Q79K probably benign Het
Vmn1r236 T A 17: 21,507,756 (GRCm39) Y291* probably null Het
Vmn2r115 T C 17: 23,578,915 (GRCm39) I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 (GRCm39) H348Q possibly damaging Het
Zfp563 T A 17: 33,321,320 (GRCm39) L40Q probably damaging Het
Other mutations in Appbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Appbp2 APN 11 85,105,143 (GRCm39) missense possibly damaging 0.86
IGL02112:Appbp2 APN 11 85,092,446 (GRCm39) missense probably benign 0.04
IGL03051:Appbp2 APN 11 85,082,565 (GRCm39) missense possibly damaging 0.90
IGL03068:Appbp2 APN 11 85,092,246 (GRCm39) missense probably damaging 1.00
IGL03260:Appbp2 APN 11 85,107,283 (GRCm39) missense probably benign 0.00
IGL03358:Appbp2 APN 11 85,100,860 (GRCm39) missense probably benign 0.17
R0017:Appbp2 UTSW 11 85,105,129 (GRCm39) missense possibly damaging 0.46
R0267:Appbp2 UTSW 11 85,092,288 (GRCm39) missense probably damaging 1.00
R0504:Appbp2 UTSW 11 85,082,513 (GRCm39) missense probably benign 0.05
R1661:Appbp2 UTSW 11 85,100,936 (GRCm39) critical splice acceptor site probably null
R3438:Appbp2 UTSW 11 85,088,966 (GRCm39) missense probably damaging 1.00
R3817:Appbp2 UTSW 11 85,088,934 (GRCm39) missense probably damaging 1.00
R3950:Appbp2 UTSW 11 85,085,532 (GRCm39) missense probably damaging 1.00
R4273:Appbp2 UTSW 11 85,125,502 (GRCm39) missense probably damaging 1.00
R4574:Appbp2 UTSW 11 85,100,764 (GRCm39) critical splice donor site probably null
R4948:Appbp2 UTSW 11 85,085,409 (GRCm39) missense possibly damaging 0.87
R5322:Appbp2 UTSW 11 85,086,890 (GRCm39) critical splice donor site probably null
R5581:Appbp2 UTSW 11 85,100,921 (GRCm39) missense possibly damaging 0.92
R5593:Appbp2 UTSW 11 85,085,409 (GRCm39) missense possibly damaging 0.87
R5698:Appbp2 UTSW 11 85,100,925 (GRCm39) missense probably damaging 1.00
R7095:Appbp2 UTSW 11 85,125,553 (GRCm39) nonsense probably null
R7141:Appbp2 UTSW 11 85,082,577 (GRCm39) nonsense probably null
R9530:Appbp2 UTSW 11 85,107,306 (GRCm39) missense probably damaging 0.99
X0058:Appbp2 UTSW 11 85,092,456 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACAGACTGGGAACTCTTGG -3'
(R):5'- TCAGACTTAGCTTCAACTCACC -3'

Sequencing Primer
(F):5'- AACTCTTGGAAGAAGCCTTCTGG -3'
(R):5'- CTCACCTTATTCTTTTGGGGAAAAC -3'
Posted On 2022-05-16