Incidental Mutation 'R9410:Abcb5'
ID 711765
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene Name ATP-binding cassette, sub-family B (MDR/TAP), member 5
Synonyms 9230106F14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 118867824-118966421 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 118905968 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 772 (S772L)
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
AlphaFold B5X0E4
Predicted Effect probably benign
Transcript: ENSMUST00000035515
AA Change: S772L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791
AA Change: S772L

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd2 A T 3: 108,075,274 V722E probably damaging Het
Appbp2 A T 11: 85,215,241 F83Y probably damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
B020004C17Rik A T 14: 57,016,816 Y132F possibly damaging Het
Ccdc114 T C 7: 45,948,397 V577A probably benign Het
Cnr1 A G 4: 33,944,973 T454A possibly damaging Het
Creb3l1 C T 2: 91,991,886 probably null Het
Ctla4 A T 1: 60,912,752 T147S probably damaging Het
Ctsa T C 2: 164,835,181 L152P probably damaging Het
Dgkh T C 14: 78,624,853 T225A probably damaging Het
Dsg1a A T 18: 20,331,533 I362F possibly damaging Het
Dzank1 C T 2: 144,482,130 probably null Het
Ephb2 A T 4: 136,659,637 C760S probably null Het
Exoc1 T A 5: 76,559,142 V512E probably benign Het
Faiml C A 9: 99,229,534 K157N probably benign Het
Fpr2 C T 17: 17,893,342 T200I probably benign Het
Fscn3 C T 6: 28,430,433 R201* probably null Het
Hcrtr1 A T 4: 130,135,721 L189Q probably damaging Het
Igkv4-62 T C 6: 69,399,848 T84A probably benign Het
Krtap2-4 C A 11: 99,614,611 R58L possibly damaging Het
Meis1 C T 11: 18,883,987 probably null Het
Mfsd2b T A 12: 4,865,747 I422F probably damaging Het
Mre11a G A 9: 14,805,420 V304M probably damaging Het
Myo5a A G 9: 75,116,214 E19G probably damaging Het
Ndufa10 A T 1: 92,439,892 Y339N probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,645,831 probably null Het
Pcdh18 G A 3: 49,745,166 P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Plin4 A G 17: 56,106,995 V210A probably benign Het
Rnf150 T C 8: 83,036,093 M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,250,273 probably benign Het
Ruvbl2 G A 7: 45,422,194 Q422* probably null Het
Shroom1 C T 11: 53,463,390 R46C probably damaging Het
Slc22a2 T C 17: 12,586,845 F161S probably damaging Het
Src T A 2: 157,469,756 M468K probably damaging Het
Stag3 T C 5: 138,299,339 F606L possibly damaging Het
Stau1 T C 2: 166,955,118 T120A probably benign Het
Sulf2 A C 2: 166,094,524 L174R Het
Sumf1 A C 6: 108,173,402 F156C probably damaging Het
Tenm2 T A 11: 36,141,569 D708V probably damaging Het
Tmprss12 A C 15: 100,292,741 I331L possibly damaging Het
Tnfrsf10b T G 14: 69,773,400 C85G probably damaging Het
Trav10d C A 14: 52,811,388 Q79K probably benign Het
Vmn1r236 T A 17: 21,287,494 Y291* probably null Het
Vmn2r115 T C 17: 23,359,941 I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 H348Q possibly damaging Het
Zfp563 T A 17: 33,102,346 L40Q probably damaging Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118890610 missense probably benign 0.03
IGL00092:Abcb5 APN 12 118928695 missense probably benign 0.09
IGL00503:Abcb5 APN 12 118907601 missense probably benign 0.02
IGL00776:Abcb5 APN 12 118919854 missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118886176 missense probably benign
IGL01302:Abcb5 APN 12 118918200 missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118872867 missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118867970 missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118911434 missense probably benign 0.03
IGL01784:Abcb5 APN 12 118890664 missense probably benign 0.14
IGL01967:Abcb5 APN 12 118867972 missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118927358 missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118940680 missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118874755 missense probably benign
IGL02292:Abcb5 APN 12 118918197 missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118940678 missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118906268 splice site probably benign
IGL02685:Abcb5 APN 12 118905947 missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118890685 missense probably benign 0.05
IGL02876:Abcb5 APN 12 118919841 missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118944939 missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118940369 missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118936087 missense probably benign 0.43
IGL03200:Abcb5 APN 12 118965254 splice site probably benign
IGL03407:Abcb5 APN 12 118940376 missense probably benign 0.01
alphabet UTSW 12 118890618 missense possibly damaging 0.67
google UTSW 12 118867930 missense possibly damaging 0.93
F5770:Abcb5 UTSW 12 118886179 missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118936098 missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118890687 missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118927394 missense probably benign
R0219:Abcb5 UTSW 12 118886150 splice site probably benign
R0312:Abcb5 UTSW 12 118872837 missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118965251 splice site probably benign
R0359:Abcb5 UTSW 12 118940332 missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118877810 missense probably benign 0.03
R0582:Abcb5 UTSW 12 118940412 missense probably benign 0.40
R0815:Abcb5 UTSW 12 118901449 splice site probably benign
R0900:Abcb5 UTSW 12 118940624 missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118906198 missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118932575 missense probably benign 0.36
R1125:Abcb5 UTSW 12 118911547 missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118874762 missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118965329 start gained probably benign
R1726:Abcb5 UTSW 12 118874801 splice site probably null
R1726:Abcb5 UTSW 12 118907532 missense possibly damaging 0.95
R1836:Abcb5 UTSW 12 118867961 missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118907500 splice site probably null
R1976:Abcb5 UTSW 12 118890682 missense probably benign
R2005:Abcb5 UTSW 12 118877827 missense probably benign 0.15
R2068:Abcb5 UTSW 12 118940568 nonsense probably null
R2181:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118867956 missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118872933 missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118874620 missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118901352 splice site probably null
R3919:Abcb5 UTSW 12 118890618 missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118868669 missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118872922 missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118932610 critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118965305 missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118911434 missense probably benign 0.03
R4966:Abcb5 UTSW 12 118886891 intron probably benign
R5169:Abcb5 UTSW 12 118877817 nonsense probably null
R5327:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R5333:Abcb5 UTSW 12 118867942 missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118867930 missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118887177 missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118911499 missense probably benign
R5416:Abcb5 UTSW 12 118907596 missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118927326 missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118940690 missense probably null 1.00
R5566:Abcb5 UTSW 12 118935967 missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118932613 splice site probably null
R5691:Abcb5 UTSW 12 118927235 missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118918257 missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118927404 missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118868781 nonsense probably null
R5994:Abcb5 UTSW 12 118965260 critical splice donor site probably null
R6295:Abcb5 UTSW 12 118874644 missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118890549 critical splice donor site probably null
R6609:Abcb5 UTSW 12 118928762 missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118944906 missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118901354 splice site probably null
R6870:Abcb5 UTSW 12 118965265 missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118911530 missense probably benign 0.06
R6957:Abcb5 UTSW 12 118907535 missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118927277 missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118931925 missense probably benign 0.00
R7061:Abcb5 UTSW 12 118877774 missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118867876 missense probably benign 0.00
R7239:Abcb5 UTSW 12 118928725 missense probably benign 0.19
R7267:Abcb5 UTSW 12 118952470 missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118911560 missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118867874 missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118918164 missense probably damaging 1.00
R7989:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R8177:Abcb5 UTSW 12 118872790 missense possibly damaging 0.65
R8296:Abcb5 UTSW 12 118874732 missense probably benign 0.01
R8544:Abcb5 UTSW 12 118868726 missense probably damaging 1.00
R8558:Abcb5 UTSW 12 118877831 missense probably benign 0.07
R8790:Abcb5 UTSW 12 118867885 missense possibly damaging 0.91
R9003:Abcb5 UTSW 12 118886278 missense possibly damaging 0.93
R9038:Abcb5 UTSW 12 118931916 missense probably benign
R9497:Abcb5 UTSW 12 118936115 missense probably damaging 0.96
V7580:Abcb5 UTSW 12 118886179 missense probably benign 0.07
Z1176:Abcb5 UTSW 12 118918272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCCCTGAAATAACATTGTGC -3'
(R):5'- AATTGACTAATCAGCCCTGGG -3'

Sequencing Primer
(F):5'- CGAGTGCAGTTCTTTCAGAAACCAG -3'
(R):5'- GGCAGGGTTACATGTTTACATTATC -3'
Posted On 2022-05-16