Incidental Mutation 'R9410:Trav10d'
ID 711767
Institutional Source Beutler Lab
Gene Symbol Trav10d
Ensembl Gene ENSMUSG00000094792
Gene Name T cell receptor alpha variable 10D
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 52810934-52811495 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 52811388 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 79 (Q79K)
Ref Sequence ENSEMBL: ENSMUSP00000100423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103646]
AlphaFold A0A075B642
Predicted Effect probably benign
Transcript: ENSMUST00000103646
AA Change: Q79K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000100423
Gene: ENSMUSG00000094792
AA Change: Q79K

DomainStartEndE-ValueType
IGv 40 114 1.33e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,905,968 S772L probably benign Het
Ampd2 A T 3: 108,075,274 V722E probably damaging Het
Appbp2 A T 11: 85,215,241 F83Y probably damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
B020004C17Rik A T 14: 57,016,816 Y132F possibly damaging Het
Ccdc114 T C 7: 45,948,397 V577A probably benign Het
Cnr1 A G 4: 33,944,973 T454A possibly damaging Het
Creb3l1 C T 2: 91,991,886 probably null Het
Ctla4 A T 1: 60,912,752 T147S probably damaging Het
Ctsa T C 2: 164,835,181 L152P probably damaging Het
Dgkh T C 14: 78,624,853 T225A probably damaging Het
Dsg1a A T 18: 20,331,533 I362F possibly damaging Het
Dzank1 C T 2: 144,482,130 probably null Het
Ephb2 A T 4: 136,659,637 C760S probably null Het
Exoc1 T A 5: 76,559,142 V512E probably benign Het
Faiml C A 9: 99,229,534 K157N probably benign Het
Fpr2 C T 17: 17,893,342 T200I probably benign Het
Fscn3 C T 6: 28,430,433 R201* probably null Het
Hcrtr1 A T 4: 130,135,721 L189Q probably damaging Het
Igkv4-62 T C 6: 69,399,848 T84A probably benign Het
Krtap2-4 C A 11: 99,614,611 R58L possibly damaging Het
Meis1 C T 11: 18,883,987 probably null Het
Mfsd2b T A 12: 4,865,747 I422F probably damaging Het
Mre11a G A 9: 14,805,420 V304M probably damaging Het
Myo5a A G 9: 75,116,214 E19G probably damaging Het
Ndufa10 A T 1: 92,439,892 Y339N probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,645,831 probably null Het
Pcdh18 G A 3: 49,745,166 P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Plin4 A G 17: 56,106,995 V210A probably benign Het
Rnf150 T C 8: 83,036,093 M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,250,273 probably benign Het
Ruvbl2 G A 7: 45,422,194 Q422* probably null Het
Shroom1 C T 11: 53,463,390 R46C probably damaging Het
Slc22a2 T C 17: 12,586,845 F161S probably damaging Het
Src T A 2: 157,469,756 M468K probably damaging Het
Stag3 T C 5: 138,299,339 F606L possibly damaging Het
Stau1 T C 2: 166,955,118 T120A probably benign Het
Sulf2 A C 2: 166,094,524 L174R Het
Sumf1 A C 6: 108,173,402 F156C probably damaging Het
Tenm2 T A 11: 36,141,569 D708V probably damaging Het
Tmprss12 A C 15: 100,292,741 I331L possibly damaging Het
Tnfrsf10b T G 14: 69,773,400 C85G probably damaging Het
Vmn1r236 T A 17: 21,287,494 Y291* probably null Het
Vmn2r115 T C 17: 23,359,941 I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 H348Q possibly damaging Het
Zfp563 T A 17: 33,102,346 L40Q probably damaging Het
Other mutations in Trav10d
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5378:Trav10d UTSW 14 52811368 missense probably benign 0.01
R5898:Trav10d UTSW 14 52811472 missense probably damaging 1.00
R5970:Trav10d UTSW 14 52811322 missense probably damaging 1.00
R8458:Trav10d UTSW 14 52811323 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGTTGTGGACAAAGAGATTTAGCAG -3'
(R):5'- TGCTTTACTACAAGACACAGGATG -3'

Sequencing Primer
(F):5'- AGAGTACTGCCTGACTGCTC -3'
(R):5'- CACAGGATGTGGATGGGGCTC -3'
Posted On 2022-05-16