Incidental Mutation 'R9410:B020004C17Rik'
ID 711768
Institutional Source Beutler Lab
Gene Symbol B020004C17Rik
Ensembl Gene ENSMUSG00000096144
Gene Name RIKEN cDNA B020004C17 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 57015134-57018982 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57016816 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 132 (Y132F)
Ref Sequence ENSEMBL: ENSMUSP00000137042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178161]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000178161
AA Change: Y132F

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137042
Gene: ENSMUSG00000096144
AA Change: Y132F

DomainStartEndE-ValueType
low complexity region 70 83 N/A INTRINSIC
low complexity region 221 231 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,905,968 S772L probably benign Het
Ampd2 A T 3: 108,075,274 V722E probably damaging Het
Appbp2 A T 11: 85,215,241 F83Y probably damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Ccdc114 T C 7: 45,948,397 V577A probably benign Het
Cnr1 A G 4: 33,944,973 T454A possibly damaging Het
Creb3l1 C T 2: 91,991,886 probably null Het
Ctla4 A T 1: 60,912,752 T147S probably damaging Het
Ctsa T C 2: 164,835,181 L152P probably damaging Het
Dgkh T C 14: 78,624,853 T225A probably damaging Het
Dsg1a A T 18: 20,331,533 I362F possibly damaging Het
Dzank1 C T 2: 144,482,130 probably null Het
Ephb2 A T 4: 136,659,637 C760S probably null Het
Exoc1 T A 5: 76,559,142 V512E probably benign Het
Faiml C A 9: 99,229,534 K157N probably benign Het
Fpr2 C T 17: 17,893,342 T200I probably benign Het
Fscn3 C T 6: 28,430,433 R201* probably null Het
Hcrtr1 A T 4: 130,135,721 L189Q probably damaging Het
Igkv4-62 T C 6: 69,399,848 T84A probably benign Het
Krtap2-4 C A 11: 99,614,611 R58L possibly damaging Het
Meis1 C T 11: 18,883,987 probably null Het
Mfsd2b T A 12: 4,865,747 I422F probably damaging Het
Mre11a G A 9: 14,805,420 V304M probably damaging Het
Myo5a A G 9: 75,116,214 E19G probably damaging Het
Ndufa10 A T 1: 92,439,892 Y339N probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,645,831 probably null Het
Pcdh18 G A 3: 49,745,166 P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Plin4 A G 17: 56,106,995 V210A probably benign Het
Rnf150 T C 8: 83,036,093 M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,250,273 probably benign Het
Ruvbl2 G A 7: 45,422,194 Q422* probably null Het
Shroom1 C T 11: 53,463,390 R46C probably damaging Het
Slc22a2 T C 17: 12,586,845 F161S probably damaging Het
Src T A 2: 157,469,756 M468K probably damaging Het
Stag3 T C 5: 138,299,339 F606L possibly damaging Het
Stau1 T C 2: 166,955,118 T120A probably benign Het
Sulf2 A C 2: 166,094,524 L174R Het
Sumf1 A C 6: 108,173,402 F156C probably damaging Het
Tenm2 T A 11: 36,141,569 D708V probably damaging Het
Tmprss12 A C 15: 100,292,741 I331L possibly damaging Het
Tnfrsf10b T G 14: 69,773,400 C85G probably damaging Het
Trav10d C A 14: 52,811,388 Q79K probably benign Het
Vmn1r236 T A 17: 21,287,494 Y291* probably null Het
Vmn2r115 T C 17: 23,359,941 I796T possibly damaging Het
Zfp189 T A 4: 49,529,942 H348Q possibly damaging Het
Zfp563 T A 17: 33,102,346 L40Q probably damaging Het
Other mutations in B020004C17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:B020004C17Rik APN 14 57016023 missense probably damaging 0.96
IGL03396:B020004C17Rik APN 14 57016536 missense possibly damaging 0.61
R0664:B020004C17Rik UTSW 14 57016768 missense possibly damaging 0.56
R3977:B020004C17Rik UTSW 14 57017188 missense possibly damaging 0.78
R3978:B020004C17Rik UTSW 14 57017188 missense possibly damaging 0.78
R3979:B020004C17Rik UTSW 14 57017188 missense possibly damaging 0.78
R4415:B020004C17Rik UTSW 14 57017417 makesense probably null
R5290:B020004C17Rik UTSW 14 57016579 missense possibly damaging 0.94
R5479:B020004C17Rik UTSW 14 57016542 missense probably benign 0.36
R5651:B020004C17Rik UTSW 14 57015232 start gained probably benign
R5655:B020004C17Rik UTSW 14 57015232 start gained probably benign
R5736:B020004C17Rik UTSW 14 57017366 missense possibly damaging 0.66
R7368:B020004C17Rik UTSW 14 57017316 missense possibly damaging 0.95
R7759:B020004C17Rik UTSW 14 57016785 missense possibly damaging 0.96
R9299:B020004C17Rik UTSW 14 57016773 missense probably damaging 0.96
Z1177:B020004C17Rik UTSW 14 57015260 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCGCCTTTCTAATCGGGG -3'
(R):5'- ATTGCCTGTCCTCTGGATCAG -3'

Sequencing Primer
(F):5'- TTCTAATCGGGGTTTGAGGAAAAGC -3'
(R):5'- CAAATTCCATTGCCTTGAGGTGTCAG -3'
Posted On 2022-05-16