Incidental Mutation 'R9410:Vmn2r115'
ID 711775
Institutional Source Beutler Lab
Gene Symbol Vmn2r115
Ensembl Gene ENSMUSG00000091076
Gene Name vomeronasal 2, receptor 115
Synonyms V2Rp4, EG638102
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R9410 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 23562951-23579102 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23578915 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 796 (I796T)
Ref Sequence ENSEMBL: ENSMUSP00000131447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168175]
AlphaFold E9Q0E7
Predicted Effect possibly damaging
Transcript: ENSMUST00000168175
AA Change: I796T

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131447
Gene: ENSMUSG00000091076
AA Change: I796T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 1.4e-28 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 598 833 5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 G A 12: 118,869,703 (GRCm39) S772L probably benign Het
Ampd2 A T 3: 107,982,590 (GRCm39) V722E probably damaging Het
Appbp2 A T 11: 85,106,067 (GRCm39) F83Y probably damaging Het
Arih2 C G 9: 108,488,938 (GRCm39) R260P probably damaging Het
B020004C17Rik A T 14: 57,254,273 (GRCm39) Y132F possibly damaging Het
Cnr1 A G 4: 33,944,973 (GRCm39) T454A possibly damaging Het
Creb3l1 C T 2: 91,822,231 (GRCm39) probably null Het
Ctla4 A T 1: 60,951,911 (GRCm39) T147S probably damaging Het
Ctsa T C 2: 164,677,101 (GRCm39) L152P probably damaging Het
Dgkh T C 14: 78,862,293 (GRCm39) T225A probably damaging Het
Dsg1a A T 18: 20,464,590 (GRCm39) I362F possibly damaging Het
Dzank1 C T 2: 144,324,050 (GRCm39) probably null Het
Ephb2 A T 4: 136,386,948 (GRCm39) C760S probably null Het
Exoc1 T A 5: 76,706,989 (GRCm39) V512E probably benign Het
Faiml C A 9: 99,111,587 (GRCm39) K157N probably benign Het
Fpr2 C T 17: 18,113,604 (GRCm39) T200I probably benign Het
Fscn3 C T 6: 28,430,432 (GRCm39) R201* probably null Het
Hcrtr1 A T 4: 130,029,514 (GRCm39) L189Q probably damaging Het
Igkv4-62 T C 6: 69,376,832 (GRCm39) T84A probably benign Het
Krtap2-4 C A 11: 99,505,437 (GRCm39) R58L possibly damaging Het
Meis1 C T 11: 18,833,987 (GRCm39) probably null Het
Mfsd2b T A 12: 4,915,747 (GRCm39) I422F probably damaging Het
Mre11a G A 9: 14,716,716 (GRCm39) V304M probably damaging Het
Myo5a A G 9: 75,023,496 (GRCm39) E19G probably damaging Het
Ndufa10 A T 1: 92,367,614 (GRCm39) Y339N probably damaging Het
Odad1 T C 7: 45,597,821 (GRCm39) V577A probably benign Het
Or2n1d A T 17: 38,646,320 (GRCm39) T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,481,663 (GRCm39) probably null Het
Pcdh18 G A 3: 49,699,615 (GRCm39) P949L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,302,525 (GRCm39) probably benign Het
Plin4 A G 17: 56,413,995 (GRCm39) V210A probably benign Het
Rnf150 T C 8: 83,762,722 (GRCm39) M319T possibly damaging Het
Rnf180 CGAGG CGAGGAGG 13: 105,386,781 (GRCm39) probably benign Het
Ruvbl2 G A 7: 45,071,618 (GRCm39) Q422* probably null Het
Shroom1 C T 11: 53,354,217 (GRCm39) R46C probably damaging Het
Slc22a2 T C 17: 12,805,732 (GRCm39) F161S probably damaging Het
Src T A 2: 157,311,676 (GRCm39) M468K probably damaging Het
Stag3 T C 5: 138,297,601 (GRCm39) F606L possibly damaging Het
Stau1 T C 2: 166,797,038 (GRCm39) T120A probably benign Het
Sulf2 A C 2: 165,936,444 (GRCm39) L174R Het
Sumf1 A C 6: 108,150,363 (GRCm39) F156C probably damaging Het
Tenm2 T A 11: 36,032,396 (GRCm39) D708V probably damaging Het
Tmprss12 A C 15: 100,190,622 (GRCm39) I331L possibly damaging Het
Tnfrsf10b T G 14: 70,010,849 (GRCm39) C85G probably damaging Het
Trav10d C A 14: 53,048,845 (GRCm39) Q79K probably benign Het
Vmn1r236 T A 17: 21,507,756 (GRCm39) Y291* probably null Het
Zfp189 T A 4: 49,529,942 (GRCm39) H348Q possibly damaging Het
Zfp563 T A 17: 33,321,320 (GRCm39) L40Q probably damaging Het
Other mutations in Vmn2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r115 APN 17 23,575,934 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23,565,345 (GRCm39) nonsense probably null
IGL00990:Vmn2r115 APN 17 23,578,371 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23,565,135 (GRCm39) missense probably benign 0.03
IGL00990:Vmn2r115 APN 17 23,565,252 (GRCm39) missense probably benign 0.14
IGL00990:Vmn2r115 APN 17 23,565,313 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23,578,323 (GRCm39) missense probably benign 0.22
IGL00990:Vmn2r115 APN 17 23,565,150 (GRCm39) missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23,565,180 (GRCm39) missense possibly damaging 0.90
IGL00990:Vmn2r115 APN 17 23,567,008 (GRCm39) nonsense probably null
IGL00990:Vmn2r115 APN 17 23,578,798 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23,578,753 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23,565,238 (GRCm39) missense probably benign 0.19
IGL00990:Vmn2r115 APN 17 23,565,346 (GRCm39) missense probably benign 0.30
IGL01073:Vmn2r115 APN 17 23,564,971 (GRCm39) missense probably benign 0.12
IGL01101:Vmn2r115 APN 17 23,564,971 (GRCm39) missense probably benign 0.12
IGL01300:Vmn2r115 APN 17 23,578,755 (GRCm39) missense probably damaging 1.00
IGL01415:Vmn2r115 APN 17 23,578,755 (GRCm39) missense probably damaging 1.00
IGL02309:Vmn2r115 APN 17 23,564,113 (GRCm39) missense probably benign 0.01
IGL02863:Vmn2r115 APN 17 23,578,257 (GRCm39) missense probably damaging 0.97
R0023:Vmn2r115 UTSW 17 23,565,252 (GRCm39) missense probably benign 0.14
R0197:Vmn2r115 UTSW 17 23,578,755 (GRCm39) missense probably damaging 1.00
R0361:Vmn2r115 UTSW 17 23,564,196 (GRCm39) missense probably benign 0.11
R0601:Vmn2r115 UTSW 17 23,579,074 (GRCm39) missense probably null 0.51
R0676:Vmn2r115 UTSW 17 23,565,238 (GRCm39) missense probably benign 0.19
R0685:Vmn2r115 UTSW 17 23,578,249 (GRCm39) missense probably benign
R0865:Vmn2r115 UTSW 17 23,565,382 (GRCm39) missense possibly damaging 0.65
R1124:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1145:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1146:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1207:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1266:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1318:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1367:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1376:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1376:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1420:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1469:Vmn2r115 UTSW 17 23,564,992 (GRCm39) missense probably damaging 0.99
R1469:Vmn2r115 UTSW 17 23,564,992 (GRCm39) missense probably damaging 0.99
R1604:Vmn2r115 UTSW 17 23,564,245 (GRCm39) missense probably benign 0.12
R1645:Vmn2r115 UTSW 17 23,565,192 (GRCm39) missense possibly damaging 0.69
R1646:Vmn2r115 UTSW 17 23,578,513 (GRCm39) missense probably damaging 1.00
R1650:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1678:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1716:Vmn2r115 UTSW 17 23,566,795 (GRCm39) missense probably benign
R1846:Vmn2r115 UTSW 17 23,578,357 (GRCm39) missense probably damaging 1.00
R1847:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1885:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R1887:Vmn2r115 UTSW 17 23,565,007 (GRCm39) missense possibly damaging 0.91
R1937:Vmn2r115 UTSW 17 23,578,388 (GRCm39) missense probably damaging 1.00
R2007:Vmn2r115 UTSW 17 23,566,927 (GRCm39) missense possibly damaging 0.94
R2120:Vmn2r115 UTSW 17 23,578,297 (GRCm39) missense probably damaging 1.00
R3161:Vmn2r115 UTSW 17 23,575,998 (GRCm39) missense possibly damaging 0.82
R3780:Vmn2r115 UTSW 17 23,564,146 (GRCm39) missense probably damaging 1.00
R3806:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R3982:Vmn2r115 UTSW 17 23,578,948 (GRCm39) missense probably damaging 1.00
R4019:Vmn2r115 UTSW 17 23,579,017 (GRCm39) missense probably damaging 1.00
R4039:Vmn2r115 UTSW 17 23,564,077 (GRCm39) missense probably benign 0.26
R4087:Vmn2r115 UTSW 17 23,565,358 (GRCm39) missense probably benign 0.35
R4089:Vmn2r115 UTSW 17 23,565,358 (GRCm39) missense probably benign 0.35
R4379:Vmn2r115 UTSW 17 23,564,197 (GRCm39) missense possibly damaging 0.95
R4417:Vmn2r115 UTSW 17 23,564,854 (GRCm39) missense probably benign 0.02
R4601:Vmn2r115 UTSW 17 23,565,373 (GRCm39) missense probably benign 0.01
R4874:Vmn2r115 UTSW 17 23,578,825 (GRCm39) missense probably damaging 1.00
R5466:Vmn2r115 UTSW 17 23,579,030 (GRCm39) missense probably damaging 1.00
R5613:Vmn2r115 UTSW 17 23,564,307 (GRCm39) missense probably benign
R5821:Vmn2r115 UTSW 17 23,566,937 (GRCm39) missense probably damaging 0.99
R6120:Vmn2r115 UTSW 17 23,565,003 (GRCm39) missense probably damaging 1.00
R6193:Vmn2r115 UTSW 17 23,575,983 (GRCm39) missense probably benign 0.01
R6213:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R6290:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
R6319:Vmn2r115 UTSW 17 23,566,877 (GRCm39) missense possibly damaging 0.70
R6495:Vmn2r115 UTSW 17 23,578,572 (GRCm39) missense probably benign 0.02
R6599:Vmn2r115 UTSW 17 23,565,006 (GRCm39) missense probably benign 0.00
R6764:Vmn2r115 UTSW 17 23,565,046 (GRCm39) missense probably damaging 1.00
R6970:Vmn2r115 UTSW 17 23,564,989 (GRCm39) missense probably benign 0.23
R7023:Vmn2r115 UTSW 17 23,578,785 (GRCm39) missense probably damaging 1.00
R7236:Vmn2r115 UTSW 17 23,578,576 (GRCm39) missense probably benign 0.01
R7353:Vmn2r115 UTSW 17 23,564,887 (GRCm39) missense possibly damaging 0.65
R7483:Vmn2r115 UTSW 17 23,565,371 (GRCm39) missense possibly damaging 0.95
R7743:Vmn2r115 UTSW 17 23,564,772 (GRCm39) nonsense probably null
R8005:Vmn2r115 UTSW 17 23,563,124 (GRCm39) nonsense probably null
R8191:Vmn2r115 UTSW 17 23,578,530 (GRCm39) missense probably damaging 1.00
R8544:Vmn2r115 UTSW 17 23,564,773 (GRCm39) missense possibly damaging 0.88
R8890:Vmn2r115 UTSW 17 23,578,497 (GRCm39) missense probably damaging 0.98
R9098:Vmn2r115 UTSW 17 23,564,803 (GRCm39) missense probably benign
R9114:Vmn2r115 UTSW 17 23,564,307 (GRCm39) missense probably benign
R9189:Vmn2r115 UTSW 17 23,564,784 (GRCm39) missense probably damaging 1.00
R9351:Vmn2r115 UTSW 17 23,578,482 (GRCm39) missense probably benign 0.05
R9397:Vmn2r115 UTSW 17 23,564,152 (GRCm39) nonsense probably null
R9593:Vmn2r115 UTSW 17 23,578,184 (GRCm39) missense probably damaging 0.99
V5622:Vmn2r115 UTSW 17 23,578,333 (GRCm39) missense probably benign
V5622:Vmn2r115 UTSW 17 23,565,201 (GRCm39) missense probably damaging 1.00
X0023:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
X0033:Vmn2r115 UTSW 17 23,578,962 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CACAAGGGTTCAGTCAATGC -3'
(R):5'- ATTCCACCATCAGAAAGGTATGG -3'

Sequencing Primer
(F):5'- AGGGTTCAGTCAATGCATTTTACTG -3'
(R):5'- ACTACGAGCATTGGAAGATGATTTC -3'
Posted On 2022-05-16