Incidental Mutation 'R9411:Garem1'
ID 711832
Institutional Source Beutler Lab
Gene Symbol Garem1
Ensembl Gene ENSMUSG00000042680
Gene Name GRB2 associated regulator of MAPK1 subtype 1
Synonyms Garem, Fam59a, LOC381126
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock # R9411 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 21127201-21300138 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 21236000 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049260]
AlphaFold Q3UFT3
Predicted Effect probably null
Transcript: ENSMUST00000049260
SMART Domains Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680

DomainStartEndE-ValueType
Pfam:CABIT 32 318 3.4e-79 PFAM
low complexity region 484 499 N/A INTRINSIC
low complexity region 512 518 N/A INTRINSIC
PDB:2DKZ|A 795 874 2e-40 PDB
Blast:SAM 808 875 2e-36 BLAST
SCOP:d1kw4a_ 812 873 4e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 G A 13: 91,771,800 A285T probably damaging Het
Arih2 C G 9: 108,611,739 R260P probably damaging Het
Arntl C A 7: 113,308,630 S513* probably null Het
Atg7 T A 6: 114,713,328 M650K probably benign Het
B020011L13Rik G A 1: 117,801,516 G251E probably benign Het
BC067074 T A 13: 113,368,233 N1965K Het
Bhlha9 T C 11: 76,673,192 V215A probably benign Het
C2cd3 T C 7: 100,416,497 V452A Het
Cd55 G A 1: 130,440,377 H370Y probably benign Het
Col6a1 A G 10: 76,711,653 V662A unknown Het
Crocc A G 4: 141,022,266 probably null Het
Dnah1 C T 14: 31,296,299 V1421M probably damaging Het
Eid3 T G 10: 82,867,818 I371S probably damaging Het
Flnc G A 6: 29,441,485 R422Q probably benign Het
Fshr T C 17: 88,985,720 Y510C probably damaging Het
Gcn1l1 C T 5: 115,595,039 T1045M possibly damaging Het
Ggt6 T A 11: 72,435,734 L39H probably damaging Het
Glrb T C 3: 80,860,303 probably null Het
Gm13119 A G 4: 144,363,427 I346V probably benign Het
Gpr171 T A 3: 59,097,890 K155* probably null Het
Has2 T A 15: 56,667,910 T470S possibly damaging Het
Ighv1-34 C T 12: 114,851,450 V31M probably damaging Het
Kdm2a A T 19: 4,362,807 N50K probably damaging Het
Mfsd9 C T 1: 40,790,532 V30M probably damaging Het
Msra A G 14: 64,233,882 I126T probably benign Het
Nkd2 G A 13: 73,821,211 L379F probably benign Het
Nr2f2 A C 7: 70,357,777 V319G Het
Ntng2 A T 2: 29,248,036 L2Q probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pcnt T C 10: 76,423,062 E523G probably damaging Het
Pllp C T 8: 94,676,240 A158T probably benign Het
Plxna4 A G 6: 32,182,747 S1431P probably damaging Het
Pramef25 A T 4: 143,949,645 F296L probably damaging Het
Prpf40a T C 2: 53,139,188 D951G unknown Het
Retn G A 8: 3,657,378 A113T probably benign Het
Rexo1 G T 10: 80,561,414 R3S Het
Rras T A 7: 45,020,555 I137N possibly damaging Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Sntb2 A G 8: 107,011,299 D493G probably damaging Het
Socs5 T C 17: 87,135,093 I487T possibly damaging Het
Spryd3 A G 15: 102,119,408 Y235H probably damaging Het
Suco T A 1: 161,838,787 I515F probably damaging Het
Syn2 T C 6: 115,254,191 V269A possibly damaging Het
Tmbim6 T C 15: 99,406,620 L186P probably damaging Het
Tmem234 T C 4: 129,602,195 Y57H probably damaging Het
Tnik C A 3: 28,630,605 P861T probably damaging Het
Tns1 A G 1: 73,953,503 L45P probably damaging Het
Veph1 T A 3: 66,087,817 D671V possibly damaging Het
Vwc2l A T 1: 70,728,821 I15F probably benign Het
Zdbf2 A T 1: 63,304,129 N556Y probably damaging Het
Zfp202 T A 9: 40,207,582 V97D probably damaging Het
Zfp800 T C 6: 28,243,431 I512V possibly damaging Het
Zkscan2 T C 7: 123,485,182 D573G probably damaging Het
Other mutations in Garem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Garem1 APN 18 21148657 missense probably damaging 1.00
IGL01588:Garem1 APN 18 21129797 missense probably damaging 0.99
IGL02171:Garem1 APN 18 21129241 missense probably damaging 0.98
IGL02270:Garem1 APN 18 21148450 missense probably damaging 1.00
IGL03149:Garem1 APN 18 21131466 missense probably damaging 1.00
R0136:Garem1 UTSW 18 21129991 missense probably damaging 0.96
R0285:Garem1 UTSW 18 21129612 missense probably benign
R0361:Garem1 UTSW 18 21299744 nonsense probably null
R1068:Garem1 UTSW 18 21168755 missense probably benign 0.00
R1537:Garem1 UTSW 18 21168874 splice site probably null
R1726:Garem1 UTSW 18 21148262 missense probably damaging 0.99
R1826:Garem1 UTSW 18 21129452 missense probably benign 0.00
R2140:Garem1 UTSW 18 21129374 missense probably damaging 1.00
R3714:Garem1 UTSW 18 21148890 missense probably damaging 1.00
R3937:Garem1 UTSW 18 21148806 nonsense probably null
R4362:Garem1 UTSW 18 21236115 missense possibly damaging 0.62
R4441:Garem1 UTSW 18 21168750 missense possibly damaging 0.92
R4747:Garem1 UTSW 18 21129943 missense probably benign
R4814:Garem1 UTSW 18 21148116 missense probably damaging 1.00
R4831:Garem1 UTSW 18 21129768 missense probably benign 0.01
R4838:Garem1 UTSW 18 21147893 missense probably benign 0.00
R5805:Garem1 UTSW 18 21148435 missense probably benign 0.04
R5963:Garem1 UTSW 18 21129430 missense probably benign 0.45
R5982:Garem1 UTSW 18 21148351 missense possibly damaging 0.64
R6134:Garem1 UTSW 18 21129824 missense probably benign 0.00
R6242:Garem1 UTSW 18 21129172 missense possibly damaging 0.72
R6453:Garem1 UTSW 18 21148739 missense probably damaging 0.99
R6485:Garem1 UTSW 18 21129837 missense probably benign 0.00
R6596:Garem1 UTSW 18 21148739 missense probably damaging 0.99
R6662:Garem1 UTSW 18 21148247 missense probably benign 0.45
R6883:Garem1 UTSW 18 21129712 missense probably benign
R6937:Garem1 UTSW 18 21147770 missense probably benign 0.00
R7027:Garem1 UTSW 18 21129994 missense probably benign
R7256:Garem1 UTSW 18 21148754 missense probably damaging 1.00
R7534:Garem1 UTSW 18 21299916 start gained probably benign
R7620:Garem1 UTSW 18 21129841 missense probably benign
R7869:Garem1 UTSW 18 21299700 missense probably damaging 1.00
R7963:Garem1 UTSW 18 21148787 missense probably damaging 0.98
R8058:Garem1 UTSW 18 21148564 missense probably damaging 1.00
R8953:Garem1 UTSW 18 21131331 critical splice donor site probably null
R9273:Garem1 UTSW 18 21148217 missense probably damaging 0.99
R9475:Garem1 UTSW 18 21148313 missense probably benign 0.00
Z1176:Garem1 UTSW 18 21129792 missense probably damaging 1.00
Z1176:Garem1 UTSW 18 21148325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCTCCAATTCCAAGACC -3'
(R):5'- TCCCAGCTTTCTCATATGGAATTG -3'

Sequencing Primer
(F):5'- GACCACAAAGGAATTCTCCATG -3'
(R):5'- GTATTTTCTAGGAGAATGCGTGGAAG -3'
Posted On 2022-05-16