Mutagenetix > Incidental Mutation

Incidental Mutation 'R9411:Garem1'

711832

Institutional Source

Beutler Lab

Gene Symbol

Garem1

Ensembl Gene

ENSMUSG00000042680

Gene Name

GRB2 associated regulator of MAPK1 subtype 1

Synonyms

Garem, Fam59a, LOC381126

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.209) question?

Stock #

R9411 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

21127201-21300138 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 21236000 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000048914 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049260]

AlphaFold

Q3UFT3

Predicted Effect

probably null
Transcript: ENSMUST00000049260

SMART Domains

Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680

Domain	Start	End	E-Value	Type
Pfam:CABIT	32	318	3.4e-79	PFAM
low complexity region	484	499	N/A	INTRINSIC
low complexity region	512	518	N/A	INTRINSIC
PDB:2DKZ\|A	795	874	2e-40	PDB
Blast:SAM	808	875	2e-36	BLAST
SCOP:d1kw4a_	812	873	4e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot12	G	A	13: 91,771,800	A285T	probably damaging	Het
Arih2	C	G	9: 108,611,739	R260P	probably damaging	Het
Arntl	C	A	7: 113,308,630	S513*	probably null	Het
Atg7	T	A	6: 114,713,328	M650K	probably benign	Het
B020011L13Rik	G	A	1: 117,801,516	G251E	probably benign	Het
BC067074	T	A	13: 113,368,233	N1965K		Het
Bhlha9	T	C	11: 76,673,192	V215A	probably benign	Het
C2cd3	T	C	7: 100,416,497	V452A		Het
Cd55	G	A	1: 130,440,377	H370Y	probably benign	Het
Col6a1	A	G	10: 76,711,653	V662A	unknown	Het
Crocc	A	G	4: 141,022,266		probably null	Het
Dnah1	C	T	14: 31,296,299	V1421M	probably damaging	Het
Eid3	T	G	10: 82,867,818	I371S	probably damaging	Het
Flnc	G	A	6: 29,441,485	R422Q	probably benign	Het
Fshr	T	C	17: 88,985,720	Y510C	probably damaging	Het
Gcn1l1	C	T	5: 115,595,039	T1045M	possibly damaging	Het
Ggt6	T	A	11: 72,435,734	L39H	probably damaging	Het
Glrb	T	C	3: 80,860,303		probably null	Het
Gm13119	A	G	4: 144,363,427	I346V	probably benign	Het
Gpr171	T	A	3: 59,097,890	K155*	probably null	Het
Has2	T	A	15: 56,667,910	T470S	possibly damaging	Het
Ighv1-34	C	T	12: 114,851,450	V31M	probably damaging	Het
Kdm2a	A	T	19: 4,362,807	N50K	probably damaging	Het
Mfsd9	C	T	1: 40,790,532	V30M	probably damaging	Het
Msra	A	G	14: 64,233,882	I126T	probably benign	Het
Nkd2	G	A	13: 73,821,211	L379F	probably benign	Het
Nr2f2	A	C	7: 70,357,777	V319G		Het
Ntng2	A	T	2: 29,248,036	L2Q	probably damaging	Het
Olfr136	A	T	17: 38,335,429	T91S	possibly damaging	Het
Pcnt	T	C	10: 76,423,062	E523G	probably damaging	Het
Pllp	C	T	8: 94,676,240	A158T	probably benign	Het
Plxna4	A	G	6: 32,182,747	S1431P	probably damaging	Het
Pramef25	A	T	4: 143,949,645	F296L	probably damaging	Het
Prpf40a	T	C	2: 53,139,188	D951G	unknown	Het
Retn	G	A	8: 3,657,378	A113T	probably benign	Het
Rexo1	G	T	10: 80,561,414	R3S		Het
Rras	T	A	7: 45,020,555	I137N	possibly damaging	Het
Rsf1	A	AAGGCGACGG	7: 97,579,904		probably null	Het
Sntb2	A	G	8: 107,011,299	D493G	probably damaging	Het
Socs5	T	C	17: 87,135,093	I487T	possibly damaging	Het
Spryd3	A	G	15: 102,119,408	Y235H	probably damaging	Het
Suco	T	A	1: 161,838,787	I515F	probably damaging	Het
Syn2	T	C	6: 115,254,191	V269A	possibly damaging	Het
Tmbim6	T	C	15: 99,406,620	L186P	probably damaging	Het
Tmem234	T	C	4: 129,602,195	Y57H	probably damaging	Het
Tnik	C	A	3: 28,630,605	P861T	probably damaging	Het
Tns1	A	G	1: 73,953,503	L45P	probably damaging	Het
Veph1	T	A	3: 66,087,817	D671V	possibly damaging	Het
Vwc2l	A	T	1: 70,728,821	I15F	probably benign	Het
Zdbf2	A	T	1: 63,304,129	N556Y	probably damaging	Het
Zfp202	T	A	9: 40,207,582	V97D	probably damaging	Het
Zfp800	T	C	6: 28,243,431	I512V	possibly damaging	Het
Zkscan2	T	C	7: 123,485,182	D573G	probably damaging	Het

Other mutations in Garem1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Garem1	APN	18	21148657	missense	probably damaging	1.00
IGL01588:Garem1	APN	18	21129797	missense	probably damaging	0.99
IGL02171:Garem1	APN	18	21129241	missense	probably damaging	0.98
IGL02270:Garem1	APN	18	21148450	missense	probably damaging	1.00
IGL03149:Garem1	APN	18	21131466	missense	probably damaging	1.00
R0136:Garem1	UTSW	18	21129991	missense	probably damaging	0.96
R0285:Garem1	UTSW	18	21129612	missense	probably benign
R0361:Garem1	UTSW	18	21299744	nonsense	probably null
R1068:Garem1	UTSW	18	21168755	missense	probably benign	0.00
R1537:Garem1	UTSW	18	21168874	splice site	probably null
R1726:Garem1	UTSW	18	21148262	missense	probably damaging	0.99
R1826:Garem1	UTSW	18	21129452	missense	probably benign	0.00
R2140:Garem1	UTSW	18	21129374	missense	probably damaging	1.00
R3714:Garem1	UTSW	18	21148890	missense	probably damaging	1.00
R3937:Garem1	UTSW	18	21148806	nonsense	probably null
R4362:Garem1	UTSW	18	21236115	missense	possibly damaging	0.62
R4441:Garem1	UTSW	18	21168750	missense	possibly damaging	0.92
R4747:Garem1	UTSW	18	21129943	missense	probably benign
R4814:Garem1	UTSW	18	21148116	missense	probably damaging	1.00
R4831:Garem1	UTSW	18	21129768	missense	probably benign	0.01
R4838:Garem1	UTSW	18	21147893	missense	probably benign	0.00
R5805:Garem1	UTSW	18	21148435	missense	probably benign	0.04
R5963:Garem1	UTSW	18	21129430	missense	probably benign	0.45
R5982:Garem1	UTSW	18	21148351	missense	possibly damaging	0.64
R6134:Garem1	UTSW	18	21129824	missense	probably benign	0.00
R6242:Garem1	UTSW	18	21129172	missense	possibly damaging	0.72
R6453:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6485:Garem1	UTSW	18	21129837	missense	probably benign	0.00
R6596:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6662:Garem1	UTSW	18	21148247	missense	probably benign	0.45
R6883:Garem1	UTSW	18	21129712	missense	probably benign
R6937:Garem1	UTSW	18	21147770	missense	probably benign	0.00
R7027:Garem1	UTSW	18	21129994	missense	probably benign
R7256:Garem1	UTSW	18	21148754	missense	probably damaging	1.00
R7534:Garem1	UTSW	18	21299916	start gained	probably benign
R7620:Garem1	UTSW	18	21129841	missense	probably benign
R7869:Garem1	UTSW	18	21299700	missense	probably damaging	1.00
R7963:Garem1	UTSW	18	21148787	missense	probably damaging	0.98
R8058:Garem1	UTSW	18	21148564	missense	probably damaging	1.00
R8953:Garem1	UTSW	18	21131331	critical splice donor site	probably null
R9273:Garem1	UTSW	18	21148217	missense	probably damaging	0.99
R9475:Garem1	UTSW	18	21148313	missense	probably benign	0.00
Z1176:Garem1	UTSW	18	21129792	missense	probably damaging	1.00
Z1176:Garem1	UTSW	18	21148325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGCTCCAATTCCAAGACC -3'
(R):5'- TCCCAGCTTTCTCATATGGAATTG -3'

Sequencing Primer
(F):5'- GACCACAAAGGAATTCTCCATG -3'
(R):5'- GTATTTTCTAGGAGAATGCGTGGAAG -3'

Posted On

2022-05-16