Incidental Mutation 'R9412:Dclk3'
ID 711859
Institutional Source Beutler Lab
Gene Symbol Dclk3
Ensembl Gene ENSMUSG00000032500
Gene Name doublecortin-like kinase 3
Synonyms Click-I, -II related, Dcamkl3
Accession Numbers

Genbank: NM_172928; MGI: 3039580

Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock # R9412 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 111439081-111489118 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 111482751 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111879]
AlphaFold Q8BWQ5
Predicted Effect probably null
Transcript: ENSMUST00000111879
SMART Domains Protein: ENSMUSP00000107510
Gene: ENSMUSG00000032500

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
Pfam:DCX 115 177 2.9e-17 PFAM
low complexity region 200 218 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
low complexity region 479 496 N/A INTRINSIC
S_TKc 514 771 1.63e-110 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. Differently from the other two closely related family members (DCLK1 and DCLK2), the protein encoded by this gene contains only one N-terminal doublecortin domain and is unable to bind microtubules and to regulate microtubule polymerization. The protein contains a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmoduline-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. [provided by RefSeq, Sep 2010]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T A 8: 13,554,695 T203S possibly damaging Het
2310035C23Rik A G 1: 105,734,563 T936A probably benign Het
2700049A03Rik G A 12: 71,188,683 E1136K possibly damaging Het
Abca6 C A 11: 110,212,233 R844L probably damaging Het
Abcb9 C T 5: 124,083,690 R207Q probably benign Het
Abcd4 T C 12: 84,608,807 R343G probably damaging Het
Arhgap45 T A 10: 80,019,730 M1K probably null Het
Art3 A G 5: 92,393,154 Y252C probably damaging Het
Ascc3 T C 10: 50,649,134 M475T probably benign Het
Atxn2 C T 5: 121,802,138 P992L possibly damaging Het
Ddx21 T C 10: 62,594,102 T288A possibly damaging Het
Fat3 T C 9: 15,997,407 D2433G probably damaging Het
Flnc G A 6: 29,441,485 R422Q probably benign Het
Fmnl2 G T 2: 53,117,004 R776L unknown Het
Fndc1 T A 17: 7,772,366 T833S unknown Het
Igf1r T A 7: 68,207,253 Y988N probably damaging Het
Ints2 T C 11: 86,226,763 Y711C probably damaging Het
Irx5 A G 8: 92,359,723 K145E probably damaging Het
Kdm5a A G 6: 120,389,030 Y377C probably damaging Het
Lrp1 T A 10: 127,573,418 T1611S probably damaging Het
Lrrc28 T A 7: 67,531,764 E241V probably damaging Het
Med23 T C 10: 24,902,121 F789S probably damaging Het
Ncapd3 C T 9: 27,056,155 Q596* probably null Het
Nrde2 C A 12: 100,130,422 E1040* probably null Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,645,831 probably null Het
Pcm1 T G 8: 41,287,751 N972K probably damaging Het
Peg10 C CTCT 6: 4,756,453 probably benign Het
Pla2g4a T C 1: 149,880,021 T222A probably damaging Het
Ptchd3 A T 11: 121,841,953 K556N possibly damaging Het
Scap T C 9: 110,378,605 C461R possibly damaging Het
Scgb1b10 T A 7: 32,101,202 L72* probably null Het
Serpinb6c C A 13: 33,897,388 A93S probably benign Het
Serpinb9c C A 13: 33,150,248 L298F probably damaging Het
Slf2 A T 19: 44,942,021 E512D probably benign Het
Snapc3 C T 4: 83,436,333 H194Y probably benign Het
Suox T A 10: 128,671,889 D90V possibly damaging Het
Supt20 TCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCA 3: 54,727,648 probably benign Het
Tert C T 13: 73,648,927 R1095W probably benign Het
Unc13c T C 9: 73,932,490 I360V probably benign Het
Uqcc1 A G 2: 155,851,409 C235R probably benign Het
Vmn2r9 T A 5: 108,843,618 I626F probably damaging Het
Vmn2r90 T G 17: 17,733,951 C792W probably damaging Het
Zcchc11 A T 4: 108,557,364 H46L Het
Zfp57 C T 17: 37,009,922 P223S probably benign Het
Zfp787 T C 7: 6,132,947 T102A probably damaging Het
Other mutations in Dclk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Dclk3 APN 9 111467843 nonsense probably null
IGL02125:Dclk3 APN 9 111469107 missense probably damaging 1.00
IGL02547:Dclk3 APN 9 111469023 missense probably damaging 1.00
IGL03393:Dclk3 APN 9 111488673 utr 3 prime probably benign
G1citation:Dclk3 UTSW 9 111439337 missense probably benign 0.03
IGL02984:Dclk3 UTSW 9 111488575 missense probably damaging 1.00
R0109:Dclk3 UTSW 9 111467670 missense possibly damaging 0.93
R0109:Dclk3 UTSW 9 111467670 missense possibly damaging 0.93
R0238:Dclk3 UTSW 9 111482628 missense probably damaging 0.99
R0238:Dclk3 UTSW 9 111482628 missense probably damaging 0.99
R0432:Dclk3 UTSW 9 111484935 missense probably damaging 1.00
R0440:Dclk3 UTSW 9 111469163 missense probably damaging 1.00
R0530:Dclk3 UTSW 9 111482721 missense probably damaging 1.00
R1024:Dclk3 UTSW 9 111469070 missense possibly damaging 0.95
R1443:Dclk3 UTSW 9 111469020 missense probably benign 0.01
R1474:Dclk3 UTSW 9 111469236 missense probably benign 0.43
R1479:Dclk3 UTSW 9 111468546 missense probably benign
R1482:Dclk3 UTSW 9 111467820 missense possibly damaging 0.90
R1543:Dclk3 UTSW 9 111468054 missense probably benign 0.04
R1552:Dclk3 UTSW 9 111488579 missense probably damaging 1.00
R1559:Dclk3 UTSW 9 111469208 missense probably damaging 1.00
R2011:Dclk3 UTSW 9 111468354 missense probably benign 0.00
R2369:Dclk3 UTSW 9 111488542 missense probably benign 0.16
R4111:Dclk3 UTSW 9 111469080 missense probably damaging 0.99
R4510:Dclk3 UTSW 9 111467992 missense probably benign 0.01
R4511:Dclk3 UTSW 9 111467992 missense probably benign 0.01
R4592:Dclk3 UTSW 9 111467895 missense probably damaging 1.00
R4604:Dclk3 UTSW 9 111469185 missense probably damaging 1.00
R4857:Dclk3 UTSW 9 111468648 missense probably benign
R4932:Dclk3 UTSW 9 111468042 missense possibly damaging 0.56
R5045:Dclk3 UTSW 9 111467788 missense probably damaging 0.99
R5233:Dclk3 UTSW 9 111468681 missense probably benign
R5338:Dclk3 UTSW 9 111469059 missense possibly damaging 0.95
R5463:Dclk3 UTSW 9 111469260 missense probably benign 0.26
R6822:Dclk3 UTSW 9 111439337 missense probably benign 0.03
R6995:Dclk3 UTSW 9 111467700 missense possibly damaging 0.88
R7187:Dclk3 UTSW 9 111484996 missense probably damaging 1.00
R7532:Dclk3 UTSW 9 111467528 missense probably benign 0.03
R7534:Dclk3 UTSW 9 111468218 missense probably benign
R7734:Dclk3 UTSW 9 111469095 missense probably damaging 1.00
R8326:Dclk3 UTSW 9 111467534 missense probably damaging 0.96
R8372:Dclk3 UTSW 9 111485013 missense probably damaging 0.98
R8388:Dclk3 UTSW 9 111482745 missense probably damaging 1.00
R8423:Dclk3 UTSW 9 111468719 missense possibly damaging 0.93
R8493:Dclk3 UTSW 9 111468147 missense probably benign 0.06
R9013:Dclk3 UTSW 9 111468498 missense probably benign 0.31
R9114:Dclk3 UTSW 9 111488615 missense probably benign 0.06
R9338:Dclk3 UTSW 9 111439305 missense unknown
X0020:Dclk3 UTSW 9 111485075 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTATGGTCTCAGTGGTACAGG -3'
(R):5'- ACATACCCAGAGAGATGCATGC -3'

Sequencing Primer
(F):5'- GTCTCAGTGGTACAGGTTACACAC -3'
(R):5'- GAGTTTCAGCTCTCTGAGA -3'
Posted On 2022-05-16