Incidental Mutation 'R9412:Nrde2'
ID 711872
Institutional Source Beutler Lab
Gene Symbol Nrde2
Ensembl Gene ENSMUSG00000021179
Gene Name nrde-2 necessary for RNA interference, domain containing
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9412 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 100125452-100159653 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 100130422 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1040 (E1040*)
Ref Sequence ENSEMBL: ENSMUSP00000021596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021596]
AlphaFold Q80XC6
Predicted Effect probably null
Transcript: ENSMUST00000021596
AA Change: E1040*
SMART Domains Protein: ENSMUSP00000021596
Gene: ENSMUSG00000021179
AA Change: E1040*

DomainStartEndE-ValueType
low complexity region 85 107 N/A INTRINSIC
low complexity region 146 154 N/A INTRINSIC
Pfam:NRDE-2 318 658 1.2e-107 PFAM
Blast:HAT 765 800 2e-10 BLAST
Blast:HAT 802 841 3e-16 BLAST
Blast:HAT 986 1018 3e-10 BLAST
Blast:HAT 1075 1109 1e-14 BLAST
Blast:HAT 1111 1143 8e-15 BLAST
low complexity region 1154 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T A 8: 13,554,695 T203S possibly damaging Het
2310035C23Rik A G 1: 105,734,563 T936A probably benign Het
2700049A03Rik G A 12: 71,188,683 E1136K possibly damaging Het
Abca6 C A 11: 110,212,233 R844L probably damaging Het
Abcb9 C T 5: 124,083,690 R207Q probably benign Het
Abcd4 T C 12: 84,608,807 R343G probably damaging Het
Arhgap45 T A 10: 80,019,730 M1K probably null Het
Art3 A G 5: 92,393,154 Y252C probably damaging Het
Ascc3 T C 10: 50,649,134 M475T probably benign Het
Atxn2 C T 5: 121,802,138 P992L possibly damaging Het
Dclk3 G A 9: 111,482,751 probably null Het
Ddx21 T C 10: 62,594,102 T288A possibly damaging Het
Fat3 T C 9: 15,997,407 D2433G probably damaging Het
Flnc G A 6: 29,441,485 R422Q probably benign Het
Fmnl2 G T 2: 53,117,004 R776L unknown Het
Fndc1 T A 17: 7,772,366 T833S unknown Het
Igf1r T A 7: 68,207,253 Y988N probably damaging Het
Ints2 T C 11: 86,226,763 Y711C probably damaging Het
Irx5 A G 8: 92,359,723 K145E probably damaging Het
Kdm5a A G 6: 120,389,030 Y377C probably damaging Het
Lrp1 T A 10: 127,573,418 T1611S probably damaging Het
Lrrc28 T A 7: 67,531,764 E241V probably damaging Het
Med23 T C 10: 24,902,121 F789S probably damaging Het
Ncapd3 C T 9: 27,056,155 Q596* probably null Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,645,831 probably null Het
Pcm1 T G 8: 41,287,751 N972K probably damaging Het
Peg10 C CTCT 6: 4,756,453 probably benign Het
Pla2g4a T C 1: 149,880,021 T222A probably damaging Het
Ptchd3 A T 11: 121,841,953 K556N possibly damaging Het
Scap T C 9: 110,378,605 C461R possibly damaging Het
Scgb1b10 T A 7: 32,101,202 L72* probably null Het
Serpinb6c C A 13: 33,897,388 A93S probably benign Het
Serpinb9c C A 13: 33,150,248 L298F probably damaging Het
Slf2 A T 19: 44,942,021 E512D probably benign Het
Snapc3 C T 4: 83,436,333 H194Y probably benign Het
Suox T A 10: 128,671,889 D90V possibly damaging Het
Supt20 TCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCA 3: 54,727,648 probably benign Het
Tert C T 13: 73,648,927 R1095W probably benign Het
Unc13c T C 9: 73,932,490 I360V probably benign Het
Uqcc1 A G 2: 155,851,409 C235R probably benign Het
Vmn2r9 T A 5: 108,843,618 I626F probably damaging Het
Vmn2r90 T G 17: 17,733,951 C792W probably damaging Het
Zcchc11 A T 4: 108,557,364 H46L Het
Zfp57 C T 17: 37,009,922 P223S probably benign Het
Zfp787 T C 7: 6,132,947 T102A probably damaging Het
Other mutations in Nrde2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02207:Nrde2 APN 12 100130931 missense probably benign 0.01
IGL02697:Nrde2 APN 12 100131207 missense probably damaging 1.00
IGL02798:Nrde2 APN 12 100143822 nonsense probably null
IGL02810:Nrde2 APN 12 100143758 missense possibly damaging 0.81
IGL02814:Nrde2 APN 12 100144135 missense probably null 0.80
IGL02990:Nrde2 APN 12 100142096 missense probably damaging 1.00
kurtz UTSW 12 100134405 missense possibly damaging 0.92
R0090:Nrde2 UTSW 12 100129286 splice site probably benign
R0576:Nrde2 UTSW 12 100132233 missense possibly damaging 0.82
R0646:Nrde2 UTSW 12 100143846 nonsense probably null
R1130:Nrde2 UTSW 12 100125670 missense probably damaging 0.97
R1216:Nrde2 UTSW 12 100149810 splice site probably benign
R1661:Nrde2 UTSW 12 100149860 missense probably benign 0.19
R2069:Nrde2 UTSW 12 100142232 missense probably damaging 1.00
R4405:Nrde2 UTSW 12 100130584 missense probably benign 0.01
R4422:Nrde2 UTSW 12 100146027 nonsense probably null
R5169:Nrde2 UTSW 12 100129293 critical splice donor site probably null
R5200:Nrde2 UTSW 12 100130497 missense possibly damaging 0.77
R5338:Nrde2 UTSW 12 100130778 missense probably damaging 1.00
R5512:Nrde2 UTSW 12 100142250 missense probably benign 0.20
R5820:Nrde2 UTSW 12 100132287 missense probably benign 0.00
R6019:Nrde2 UTSW 12 100132242 missense probably benign 0.04
R6346:Nrde2 UTSW 12 100132306 missense probably benign 0.01
R6378:Nrde2 UTSW 12 100130757 missense probably damaging 0.99
R6479:Nrde2 UTSW 12 100143948 missense probably benign 0.00
R6523:Nrde2 UTSW 12 100134405 missense possibly damaging 0.92
R7073:Nrde2 UTSW 12 100132488 missense probably benign 0.00
R7220:Nrde2 UTSW 12 100130919 missense probably benign 0.05
R7412:Nrde2 UTSW 12 100142250 nonsense probably null
R7505:Nrde2 UTSW 12 100132498 missense probably benign 0.15
R7699:Nrde2 UTSW 12 100130835 missense probably benign 0.16
R7700:Nrde2 UTSW 12 100130835 missense probably benign 0.16
R7733:Nrde2 UTSW 12 100144140 missense possibly damaging 0.92
R7868:Nrde2 UTSW 12 100131187 missense possibly damaging 0.65
R7963:Nrde2 UTSW 12 100149868 missense probably damaging 0.99
R8131:Nrde2 UTSW 12 100142243 missense probably benign 0.02
R8213:Nrde2 UTSW 12 100131003 missense probably benign
R9061:Nrde2 UTSW 12 100143864 missense probably benign 0.00
R9142:Nrde2 UTSW 12 100151259 missense probably benign 0.15
R9371:Nrde2 UTSW 12 100126218 missense probably benign 0.09
R9468:Nrde2 UTSW 12 100140009 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCTAAAGCAGTCACACC -3'
(R):5'- GCATGATGCACACAAGCCTG -3'

Sequencing Primer
(F):5'- GCTAAAGCAGTCACACCAGGTG -3'
(R):5'- GCGATTCCACATGAACGTTTG -3'
Posted On 2022-05-16