Incidental Mutation 'R9412:Serpinb6c'
ID 711874
Institutional Source Beutler Lab
Gene Symbol Serpinb6c
Ensembl Gene ENSMUSG00000052180
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6c
Synonyms Spi3C, SPIC, ovalbumin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R9412 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 33879816-33905708 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 33897388 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 93 (A93S)
Ref Sequence ENSEMBL: ENSMUSP00000127619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110273] [ENSMUST00000172184] [ENSMUST00000222216]
AlphaFold W4VSP4
Predicted Effect probably benign
Transcript: ENSMUST00000110273
AA Change: A93S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105902
Gene: ENSMUSG00000052180
AA Change: A93S

DomainStartEndE-ValueType
SERPIN 13 378 7.5e-170 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172184
AA Change: A93S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000127619
Gene: ENSMUSG00000052180
AA Change: A93S

DomainStartEndE-ValueType
SERPIN 14 379 7.5e-170 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222216
AA Change: A93S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T A 8: 13,554,695 T203S possibly damaging Het
2310035C23Rik A G 1: 105,734,563 T936A probably benign Het
2700049A03Rik G A 12: 71,188,683 E1136K possibly damaging Het
Abca6 C A 11: 110,212,233 R844L probably damaging Het
Abcb9 C T 5: 124,083,690 R207Q probably benign Het
Abcd4 T C 12: 84,608,807 R343G probably damaging Het
Arhgap45 T A 10: 80,019,730 M1K probably null Het
Art3 A G 5: 92,393,154 Y252C probably damaging Het
Ascc3 T C 10: 50,649,134 M475T probably benign Het
Atxn2 C T 5: 121,802,138 P992L possibly damaging Het
Dclk3 G A 9: 111,482,751 probably null Het
Ddx21 T C 10: 62,594,102 T288A possibly damaging Het
Fat3 T C 9: 15,997,407 D2433G probably damaging Het
Flnc G A 6: 29,441,485 R422Q probably benign Het
Fmnl2 G T 2: 53,117,004 R776L unknown Het
Fndc1 T A 17: 7,772,366 T833S unknown Het
Igf1r T A 7: 68,207,253 Y988N probably damaging Het
Ints2 T C 11: 86,226,763 Y711C probably damaging Het
Irx5 A G 8: 92,359,723 K145E probably damaging Het
Kdm5a A G 6: 120,389,030 Y377C probably damaging Het
Lrp1 T A 10: 127,573,418 T1611S probably damaging Het
Lrrc28 T A 7: 67,531,764 E241V probably damaging Het
Med23 T C 10: 24,902,121 F789S probably damaging Het
Ncapd3 C T 9: 27,056,155 Q596* probably null Het
Nrde2 C A 12: 100,130,422 E1040* probably null Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pcdh15 CAGAGA CAGA 10: 74,645,831 probably null Het
Pcm1 T G 8: 41,287,751 N972K probably damaging Het
Peg10 C CTCT 6: 4,756,453 probably benign Het
Pla2g4a T C 1: 149,880,021 T222A probably damaging Het
Ptchd3 A T 11: 121,841,953 K556N possibly damaging Het
Scap T C 9: 110,378,605 C461R possibly damaging Het
Scgb1b10 T A 7: 32,101,202 L72* probably null Het
Serpinb9c C A 13: 33,150,248 L298F probably damaging Het
Slf2 A T 19: 44,942,021 E512D probably benign Het
Snapc3 C T 4: 83,436,333 H194Y probably benign Het
Suox T A 10: 128,671,889 D90V possibly damaging Het
Supt20 TCAGCAGCAGCAGCAGCAGCAGCA TCAGCAGCAGCAGCAGCAGCA 3: 54,727,648 probably benign Het
Tert C T 13: 73,648,927 R1095W probably benign Het
Unc13c T C 9: 73,932,490 I360V probably benign Het
Uqcc1 A G 2: 155,851,409 C235R probably benign Het
Vmn2r9 T A 5: 108,843,618 I626F probably damaging Het
Vmn2r90 T G 17: 17,733,951 C792W probably damaging Het
Zcchc11 A T 4: 108,557,364 H46L Het
Zfp57 C T 17: 37,009,922 P223S probably benign Het
Zfp787 T C 7: 6,132,947 T102A probably damaging Het
Other mutations in Serpinb6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Serpinb6c APN 13 33897338 splice site probably null
IGL01900:Serpinb6c APN 13 33880190 missense possibly damaging 0.88
IGL01983:Serpinb6c APN 13 33897334 splice site probably benign
IGL03357:Serpinb6c APN 13 33895386 missense probably benign 0.08
R0208:Serpinb6c UTSW 13 33897396 missense probably benign
R0242:Serpinb6c UTSW 13 33899247 splice site probably benign
R0632:Serpinb6c UTSW 13 33880031 missense possibly damaging 0.86
R0669:Serpinb6c UTSW 13 33899269 missense probably damaging 0.98
R0848:Serpinb6c UTSW 13 33899305 missense probably damaging 1.00
R1657:Serpinb6c UTSW 13 33880226 missense probably benign 0.01
R3911:Serpinb6c UTSW 13 33893905 missense probably benign 0.00
R5135:Serpinb6c UTSW 13 33880097 missense probably damaging 1.00
R5275:Serpinb6c UTSW 13 33893817 missense probably damaging 1.00
R5295:Serpinb6c UTSW 13 33893817 missense probably damaging 1.00
R5700:Serpinb6c UTSW 13 33899308 missense probably damaging 1.00
R7490:Serpinb6c UTSW 13 33893835 missense probably benign 0.04
R7514:Serpinb6c UTSW 13 33897403 nonsense probably null
R7517:Serpinb6c UTSW 13 33895295 missense probably damaging 1.00
R7547:Serpinb6c UTSW 13 33893892 missense possibly damaging 0.80
R7730:Serpinb6c UTSW 13 33899309 missense probably damaging 1.00
R8121:Serpinb6c UTSW 13 33880218 missense probably benign 0.38
R8142:Serpinb6c UTSW 13 33880113 missense probably benign 0.00
R8745:Serpinb6c UTSW 13 33880719 missense probably benign 0.06
R8855:Serpinb6c UTSW 13 33899326 missense probably damaging 1.00
R8866:Serpinb6c UTSW 13 33899326 missense probably damaging 1.00
X0063:Serpinb6c UTSW 13 33880705 missense possibly damaging 0.76
Z1088:Serpinb6c UTSW 13 33893872 missense probably damaging 1.00
Z1088:Serpinb6c UTSW 13 33893923 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAAGTACCGTTCATGTGGG -3'
(R):5'- AGGACCCTAGACATGGAACCTTC -3'

Sequencing Primer
(F):5'- ACCGTTCATGTGGGTCTGTACC -3'
(R):5'- AATGAGCTTAGGGTTGACTCATTTCC -3'
Posted On 2022-05-16