Incidental Mutation 'R9413:Prrx1'
ID 711882
Institutional Source Beutler Lab
Gene Symbol Prrx1
Ensembl Gene ENSMUSG00000026586
Gene Name paired related homeobox 1
Synonyms mHox, mHox, Pmx1, Prx1, A230024N07Rik, K-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9413 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 163245119-163313710 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 163312613 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 8 (V8A)
Ref Sequence ENSEMBL: ENSMUSP00000134338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027878] [ENSMUST00000075805] [ENSMUST00000174397]
AlphaFold P63013
Predicted Effect probably benign
Transcript: ENSMUST00000027878
AA Change: V8A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027878
Gene: ENSMUSG00000026586
AA Change: V8A

DomainStartEndE-ValueType
HOX 94 156 4.93e-26 SMART
Pfam:OAR 219 236 7.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075805
AA Change: V8A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075203
Gene: ENSMUSG00000026586
AA Change: V8A

DomainStartEndE-ValueType
HOX 94 156 4.93e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174098
Predicted Effect probably benign
Transcript: ENSMUST00000174397
AA Change: V8A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134338
Gene: ENSMUSG00000026586
AA Change: V8A

DomainStartEndE-ValueType
HOX 94 156 4.93e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192190
Meta Mutation Damage Score 0.0713 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription co-activator, enhancing the DNA-binding activity of serum response factor, a protein required for the induction of genes by growth and differentiation factors. The protein regulates muscle creatine kinase, indicating a role in the establishment of diverse mesodermal muscle types. Alternative splicing yields two isoforms that differ in abundance and expression patterns. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skeletal defects affecting mandible, limbs, and vertebrae, vascular abnormalities, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,199 T1194S probably benign Het
Akr7a5 A T 4: 139,310,748 probably benign Het
Ap3b2 G T 7: 81,478,009 P140T possibly damaging Het
Ap3s1 T C 18: 46,754,464 probably null Het
Arrdc2 C T 8: 70,836,248 R381H probably damaging Het
Atg13 T C 2: 91,681,625 D286G probably benign Het
C1qtnf4 T C 2: 90,890,304 F307S probably damaging Het
Cdk5rap1 A T 2: 154,365,960 probably null Het
Chsy3 C T 18: 59,176,098 A141V possibly damaging Het
Creb3l1 C T 2: 91,991,886 probably null Het
D5Ertd579e A G 5: 36,614,934 S706P probably damaging Het
Ell2 A G 13: 75,769,586 D545G Het
Ephb6 T C 6: 41,614,575 L222P Het
Flnc G A 6: 29,441,485 R422Q probably benign Het
Gm6619 A T 6: 131,491,407 D167V unknown Het
Gucy2c T C 6: 136,723,773 D581G possibly damaging Het
Hectd1 G A 12: 51,746,097 R2471* probably null Het
Kif1a A T 1: 93,021,297 M1501K probably benign Het
Mycbpap A G 11: 94,501,495 V390A probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pex3 A G 10: 13,534,710 Y236H probably damaging Het
Pglyrp3 G T 3: 92,022,799 A91S probably damaging Het
Ppp1ca T C 19: 4,194,898 S292P probably damaging Het
Prkci T C 3: 31,043,766 V455A probably damaging Het
Psd4 C T 2: 24,397,460 T468I probably benign Het
Rnf213 A G 11: 119,466,233 E4203G Het
Snrnp27 T C 6: 86,676,273 D121G possibly damaging Het
Spag6 A T 2: 18,734,218 M320L probably benign Het
Spata16 T A 3: 26,924,337 M484K possibly damaging Het
Trim69 G A 2: 122,178,602 W381* probably null Het
Tubgcp3 A C 8: 12,624,885 I745S probably damaging Het
Ubxn2b A G 4: 6,204,607 D156G probably damaging Het
Vmn2r103 A G 17: 19,811,896 N644S possibly damaging Het
Other mutations in Prrx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Prrx1 APN 1 163261967 missense probably damaging 1.00
IGL01103:Prrx1 APN 1 163261962 missense probably damaging 1.00
R0309:Prrx1 UTSW 1 163312559 missense possibly damaging 0.62
R0620:Prrx1 UTSW 1 163257816 missense probably damaging 1.00
R0624:Prrx1 UTSW 1 163248405 unclassified probably benign
R1728:Prrx1 UTSW 1 163261967 missense probably damaging 1.00
R1784:Prrx1 UTSW 1 163261967 missense probably damaging 1.00
R2497:Prrx1 UTSW 1 163248265 missense possibly damaging 0.94
R3148:Prrx1 UTSW 1 163257848 missense probably benign 0.38
R3729:Prrx1 UTSW 1 163261877 missense probably damaging 1.00
R4667:Prrx1 UTSW 1 163254047 missense probably benign 0.18
R4730:Prrx1 UTSW 1 163312613 missense probably benign
R4768:Prrx1 UTSW 1 163257765 missense probably damaging 1.00
R5222:Prrx1 UTSW 1 163261973 missense probably damaging 1.00
R5448:Prrx1 UTSW 1 163248298 missense probably damaging 0.99
R7034:Prrx1 UTSW 1 163248338 missense probably benign 0.37
R7036:Prrx1 UTSW 1 163248338 missense probably benign 0.37
R7529:Prrx1 UTSW 1 163253964 splice site probably null
R8020:Prrx1 UTSW 1 163248262 missense probably damaging 0.97
Z1088:Prrx1 UTSW 1 163261877 missense probably damaging 1.00
Z1177:Prrx1 UTSW 1 163312465 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCACTCACTGTCCTGCTGAG -3'
(R):5'- TTCTACACTTCAGAAGGGGTCCC -3'

Sequencing Primer
(F):5'- ACTGGTCAGTCCCGGTGAC -3'
(R):5'- GGTCCCACCCTCTGTTTCTC -3'
Posted On 2022-05-16