Incidental Mutation 'R9413:Ubxn2b'
ID 711893
Institutional Source Beutler Lab
Gene Symbol Ubxn2b
Ensembl Gene ENSMUSG00000028243
Gene Name UBX domain protein 2B
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R9413 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 6191098-6221688 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6204607 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 156 (D156G)
Ref Sequence ENSEMBL: ENSMUSP00000029907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029907]
AlphaFold Q0KL01
Predicted Effect probably damaging
Transcript: ENSMUST00000029907
AA Change: D156G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029907
Gene: ENSMUSG00000028243
AA Change: D156G

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
SEP 138 232 3.5e-39 SMART
UBX 251 330 1.05e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,199 T1194S probably benign Het
Akr7a5 A T 4: 139,310,748 probably benign Het
Ap3b2 G T 7: 81,478,009 P140T possibly damaging Het
Ap3s1 T C 18: 46,754,464 probably null Het
Arrdc2 C T 8: 70,836,248 R381H probably damaging Het
Atg13 T C 2: 91,681,625 D286G probably benign Het
C1qtnf4 T C 2: 90,890,304 F307S probably damaging Het
Cdk5rap1 A T 2: 154,365,960 probably null Het
Chsy3 C T 18: 59,176,098 A141V possibly damaging Het
Creb3l1 C T 2: 91,991,886 probably null Het
D5Ertd579e A G 5: 36,614,934 S706P probably damaging Het
Ell2 A G 13: 75,769,586 D545G Het
Ephb6 T C 6: 41,614,575 L222P Het
Flnc G A 6: 29,441,485 R422Q probably benign Het
Gm6619 A T 6: 131,491,407 D167V unknown Het
Gucy2c T C 6: 136,723,773 D581G possibly damaging Het
Hectd1 G A 12: 51,746,097 R2471* probably null Het
Kif1a A T 1: 93,021,297 M1501K probably benign Het
Mycbpap A G 11: 94,501,495 V390A probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pex3 A G 10: 13,534,710 Y236H probably damaging Het
Pglyrp3 G T 3: 92,022,799 A91S probably damaging Het
Ppp1ca T C 19: 4,194,898 S292P probably damaging Het
Prkci T C 3: 31,043,766 V455A probably damaging Het
Prrx1 A G 1: 163,312,613 V8A probably benign Het
Psd4 C T 2: 24,397,460 T468I probably benign Het
Rnf213 A G 11: 119,466,233 E4203G Het
Snrnp27 T C 6: 86,676,273 D121G possibly damaging Het
Spag6 A T 2: 18,734,218 M320L probably benign Het
Spata16 T A 3: 26,924,337 M484K possibly damaging Het
Trim69 G A 2: 122,178,602 W381* probably null Het
Tubgcp3 A C 8: 12,624,885 I745S probably damaging Het
Vmn2r103 A G 17: 19,811,896 N644S possibly damaging Het
Other mutations in Ubxn2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Ubxn2b APN 4 6203767 splice site probably null
IGL02096:Ubxn2b APN 4 6214749 missense probably damaging 1.00
IGL02272:Ubxn2b APN 4 6216071 missense probably damaging 1.00
R0081:Ubxn2b UTSW 4 6203875 splice site probably benign
R0482:Ubxn2b UTSW 4 6196404 splice site probably null
R1903:Ubxn2b UTSW 4 6208889 missense possibly damaging 0.82
R4206:Ubxn2b UTSW 4 6204565 missense probably damaging 0.99
R5071:Ubxn2b UTSW 4 6214746 missense probably damaging 1.00
R7622:Ubxn2b UTSW 4 6214692 missense probably damaging 0.98
R8034:Ubxn2b UTSW 4 6191167 missense probably benign 0.06
R8836:Ubxn2b UTSW 4 6216061 missense probably damaging 1.00
R9156:Ubxn2b UTSW 4 6214646 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAAGGTTAGCTTCGAGTAAAG -3'
(R):5'- GGGAGAGAAGCTATTTTGTCCAAC -3'

Sequencing Primer
(F):5'- GGGAGATACCTCATTGAAAC -3'
(R):5'- CCTATTTGGCGAATTCTCAGCAAGTG -3'
Posted On 2022-05-16