Incidental Mutation 'R9413:D5Ertd579e'
ID 711894
Institutional Source Beutler Lab
Gene Symbol D5Ertd579e
Ensembl Gene ENSMUSG00000029190
Gene Name DNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock # R9413 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 36600485-36696024 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36614934 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 706 (S706P)
Ref Sequence ENSEMBL: ENSMUSP00000031091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031091]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000031091
AA Change: S706P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031091
Gene: ENSMUSG00000029190
AA Change: S706P

DomainStartEndE-ValueType
Pfam:DUF4603 23 1303 N/A PFAM
low complexity region 1365 1376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132383
SMART Domains Protein: ENSMUSP00000116548
Gene: ENSMUSG00000029190

DomainStartEndE-ValueType
Pfam:DUF4603 1 1181 N/A PFAM
low complexity region 1243 1254 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,199 T1194S probably benign Het
Akr7a5 A T 4: 139,310,748 probably benign Het
Ap3b2 G T 7: 81,478,009 P140T possibly damaging Het
Ap3s1 T C 18: 46,754,464 probably null Het
Arrdc2 C T 8: 70,836,248 R381H probably damaging Het
Atg13 T C 2: 91,681,625 D286G probably benign Het
C1qtnf4 T C 2: 90,890,304 F307S probably damaging Het
Cdk5rap1 A T 2: 154,365,960 probably null Het
Chsy3 C T 18: 59,176,098 A141V possibly damaging Het
Creb3l1 C T 2: 91,991,886 probably null Het
Ell2 A G 13: 75,769,586 D545G Het
Ephb6 T C 6: 41,614,575 L222P Het
Flnc G A 6: 29,441,485 R422Q probably benign Het
Gm6619 A T 6: 131,491,407 D167V unknown Het
Gucy2c T C 6: 136,723,773 D581G possibly damaging Het
Hectd1 G A 12: 51,746,097 R2471* probably null Het
Kif1a A T 1: 93,021,297 M1501K probably benign Het
Mycbpap A G 11: 94,501,495 V390A probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pex3 A G 10: 13,534,710 Y236H probably damaging Het
Pglyrp3 G T 3: 92,022,799 A91S probably damaging Het
Ppp1ca T C 19: 4,194,898 S292P probably damaging Het
Prkci T C 3: 31,043,766 V455A probably damaging Het
Prrx1 A G 1: 163,312,613 V8A probably benign Het
Psd4 C T 2: 24,397,460 T468I probably benign Het
Rnf213 A G 11: 119,466,233 E4203G Het
Snrnp27 T C 6: 86,676,273 D121G possibly damaging Het
Spag6 A T 2: 18,734,218 M320L probably benign Het
Spata16 T A 3: 26,924,337 M484K possibly damaging Het
Trim69 G A 2: 122,178,602 W381* probably null Het
Tubgcp3 A C 8: 12,624,885 I745S probably damaging Het
Ubxn2b A G 4: 6,204,607 D156G probably damaging Het
Vmn2r103 A G 17: 19,811,896 N644S possibly damaging Het
Other mutations in D5Ertd579e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:D5Ertd579e APN 5 36618754 missense probably damaging 0.99
IGL01925:D5Ertd579e APN 5 36614284 missense possibly damaging 0.67
IGL01933:D5Ertd579e APN 5 36615756 missense probably benign
IGL02164:D5Ertd579e APN 5 36614959 missense probably damaging 1.00
IGL02399:D5Ertd579e APN 5 36616185 missense probably damaging 1.00
IGL02896:D5Ertd579e APN 5 36613982 missense possibly damaging 0.70
IGL03141:D5Ertd579e APN 5 36613277 missense possibly damaging 0.94
IGL03235:D5Ertd579e APN 5 36618828 splice site probably benign
R0201:D5Ertd579e UTSW 5 36616465 missense probably damaging 1.00
R0377:D5Ertd579e UTSW 5 36604567 missense probably benign 0.12
R0830:D5Ertd579e UTSW 5 36613757 missense probably damaging 1.00
R0926:D5Ertd579e UTSW 5 36672866 missense probably damaging 1.00
R1350:D5Ertd579e UTSW 5 36613737 missense probably damaging 1.00
R1448:D5Ertd579e UTSW 5 36602739 missense probably benign
R1672:D5Ertd579e UTSW 5 36613277 missense possibly damaging 0.50
R1676:D5Ertd579e UTSW 5 36616109 missense probably benign 0.01
R1693:D5Ertd579e UTSW 5 36614097 missense probably damaging 0.98
R1698:D5Ertd579e UTSW 5 36604530 missense probably benign
R1868:D5Ertd579e UTSW 5 36616427 missense probably damaging 0.99
R1909:D5Ertd579e UTSW 5 36614058 missense probably benign 0.21
R2034:D5Ertd579e UTSW 5 36613538 nonsense probably null
R2080:D5Ertd579e UTSW 5 36616206 missense probably benign 0.01
R2105:D5Ertd579e UTSW 5 36613449 missense probably benign 0.12
R2197:D5Ertd579e UTSW 5 36614793 missense possibly damaging 0.69
R4212:D5Ertd579e UTSW 5 36614479 missense probably damaging 0.99
R4452:D5Ertd579e UTSW 5 36616470 missense probably damaging 1.00
R4626:D5Ertd579e UTSW 5 36614559 missense possibly damaging 0.92
R4804:D5Ertd579e UTSW 5 36629652 splice site probably null
R4898:D5Ertd579e UTSW 5 36614941 missense probably damaging 0.99
R4917:D5Ertd579e UTSW 5 36615816 missense probably damaging 1.00
R4960:D5Ertd579e UTSW 5 36616227 nonsense probably null
R4973:D5Ertd579e UTSW 5 36672905 missense probably benign
R5092:D5Ertd579e UTSW 5 36602703 missense probably benign 0.18
R5474:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5475:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5476:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5477:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5801:D5Ertd579e UTSW 5 36604569 missense probably damaging 1.00
R6019:D5Ertd579e UTSW 5 36629692 missense possibly damaging 0.90
R6184:D5Ertd579e UTSW 5 36629783 missense probably damaging 0.99
R6213:D5Ertd579e UTSW 5 36602634 missense probably damaging 1.00
R6244:D5Ertd579e UTSW 5 36615276 missense probably damaging 0.98
R6276:D5Ertd579e UTSW 5 36604514 missense possibly damaging 0.66
R6285:D5Ertd579e UTSW 5 36615577 missense probably damaging 1.00
R6358:D5Ertd579e UTSW 5 36616236 splice site probably null
R6875:D5Ertd579e UTSW 5 36604657 splice site probably null
R6967:D5Ertd579e UTSW 5 36615756 missense probably benign
R7139:D5Ertd579e UTSW 5 36613976 missense probably damaging 1.00
R7329:D5Ertd579e UTSW 5 36616395 missense probably benign 0.21
R7464:D5Ertd579e UTSW 5 36613785 missense probably damaging 0.99
R7664:D5Ertd579e UTSW 5 36614617 missense probably benign 0.00
R7762:D5Ertd579e UTSW 5 36613381 missense
R7951:D5Ertd579e UTSW 5 36615173 missense probably benign
R8175:D5Ertd579e UTSW 5 36615470 missense probably damaging 1.00
R8217:D5Ertd579e UTSW 5 36614058 missense probably benign 0.00
R8233:D5Ertd579e UTSW 5 36615244 missense probably damaging 0.99
R8281:D5Ertd579e UTSW 5 36613320 missense
R8398:D5Ertd579e UTSW 5 36614277 nonsense probably null
R8673:D5Ertd579e UTSW 5 36672807 missense probably benign 0.03
R8771:D5Ertd579e UTSW 5 36604596 missense probably damaging 1.00
R8853:D5Ertd579e UTSW 5 36629680 missense probably damaging 0.99
R9106:D5Ertd579e UTSW 5 36616338 missense probably benign 0.39
R9121:D5Ertd579e UTSW 5 36615434 missense probably damaging 1.00
R9569:D5Ertd579e UTSW 5 36602635 missense probably damaging 0.97
R9715:D5Ertd579e UTSW 5 36629685 missense possibly damaging 0.94
R9723:D5Ertd579e UTSW 5 36614940 missense probably damaging 0.99
RF022:D5Ertd579e UTSW 5 36614662 missense probably damaging 1.00
X0019:D5Ertd579e UTSW 5 36613958 missense probably damaging 1.00
Z1176:D5Ertd579e UTSW 5 36615762 missense probably benign 0.00
Z1189:D5Ertd579e UTSW 5 36614906 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGGCAAGTTTCATCCTG -3'
(R):5'- GCAATCAAGAGCCCTTTTCC -3'

Sequencing Primer
(F):5'- GACTCTGGGAACCACATAAT -3'
(R):5'- GAGCCCTTTTCCAATATTAATGAAGG -3'
Posted On 2022-05-16