Mutagenetix > Incidental Mutation

Incidental Mutation 'R9413:Ephb6'

711896

Institutional Source

Beutler Lab

Gene Symbol

Ephb6

Ensembl Gene

ENSMUSG00000029869

Gene Name

Eph receptor B6

Synonyms

Cekl, Mep

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.697) question?

Stock #

R9413 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41605482-41620509 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 41614575 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 222 (L222P)

Ref Sequence

ENSEMBL: ENSMUSP00000110380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114732]

AlphaFold

O08644

Predicted Effect

SMART Domains

Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869
AA Change: L222P

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
EPH_lbd	34	227	2.18e-100	SMART
low complexity region	242	255	N/A	INTRINSIC
Pfam:GCC2_GCC3	299	341	1.9e-9	PFAM
FN3	365	462	3.59e-3	SMART
FN3	481	562	3.73e-10	SMART
Pfam:EphA2_TM	589	660	3.4e-16	PFAM
Pfam:Pkinase	663	908	1.4e-29	PFAM
Pfam:Pkinase_Tyr	663	908	1.1e-67	PFAM
SAM	938	1005	1e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167082

Meta Mutation Damage Score

0.0845

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: T cell responses such as lymphokine secretion, proliferation, and the development of delayed-type skin hypersensitivity and experimental autoimmune encephalitis were compromised in homozygous null mutants. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,527,199	T1194S	probably benign	Het
Akr7a5	A	T	4: 139,310,748		probably benign	Het
Ap3b2	G	T	7: 81,478,009	P140T	possibly damaging	Het
Ap3s1	T	C	18: 46,754,464		probably null	Het
Arrdc2	C	T	8: 70,836,248	R381H	probably damaging	Het
Atg13	T	C	2: 91,681,625	D286G	probably benign	Het
C1qtnf4	T	C	2: 90,890,304	F307S	probably damaging	Het
Cdk5rap1	A	T	2: 154,365,960		probably null	Het
Chsy3	C	T	18: 59,176,098	A141V	possibly damaging	Het
Creb3l1	C	T	2: 91,991,886		probably null	Het
D5Ertd579e	A	G	5: 36,614,934	S706P	probably damaging	Het
Ell2	A	G	13: 75,769,586	D545G		Het
Flnc	G	A	6: 29,441,485	R422Q	probably benign	Het
Gm6619	A	T	6: 131,491,407	D167V	unknown	Het
Gucy2c	T	C	6: 136,723,773	D581G	possibly damaging	Het
Hectd1	G	A	12: 51,746,097	R2471*	probably null	Het
Kif1a	A	T	1: 93,021,297	M1501K	probably benign	Het
Mycbpap	A	G	11: 94,501,495	V390A	probably damaging	Het
Olfr136	A	T	17: 38,335,429	T91S	possibly damaging	Het
Pex3	A	G	10: 13,534,710	Y236H	probably damaging	Het
Pglyrp3	G	T	3: 92,022,799	A91S	probably damaging	Het
Ppp1ca	T	C	19: 4,194,898	S292P	probably damaging	Het
Prkci	T	C	3: 31,043,766	V455A	probably damaging	Het
Prrx1	A	G	1: 163,312,613	V8A	probably benign	Het
Psd4	C	T	2: 24,397,460	T468I	probably benign	Het
Rnf213	A	G	11: 119,466,233	E4203G		Het
Snrnp27	T	C	6: 86,676,273	D121G	possibly damaging	Het
Spag6	A	T	2: 18,734,218	M320L	probably benign	Het
Spata16	T	A	3: 26,924,337	M484K	possibly damaging	Het
Trim69	G	A	2: 122,178,602	W381*	probably null	Het
Tubgcp3	A	C	8: 12,624,885	I745S	probably damaging	Het
Ubxn2b	A	G	4: 6,204,607	D156G	probably damaging	Het
Vmn2r103	A	G	17: 19,811,896	N644S	possibly damaging	Het

Other mutations in Ephb6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Ephb6	APN	6	41615911	unclassified	probably benign
IGL01691:Ephb6	APN	6	41614515	missense	probably benign	0.26
IGL02052:Ephb6	APN	6	41613322	missense	probably benign
IGL02079:Ephb6	APN	6	41616014	missense	possibly damaging	0.57
IGL03089:Ephb6	APN	6	41614174	missense	probably damaging	1.00
P4748:Ephb6	UTSW	6	41617285	missense	probably damaging	0.96
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0974:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1610:Ephb6	UTSW	6	41614373	nonsense	probably null
R1658:Ephb6	UTSW	6	41614245	missense	probably damaging	1.00
R1687:Ephb6	UTSW	6	41617366	missense	probably benign	0.08
R1733:Ephb6	UTSW	6	41619720	missense	probably benign	0.10
R2191:Ephb6	UTSW	6	41616085	missense	possibly damaging	0.82
R2439:Ephb6	UTSW	6	41618735	missense	probably benign	0.31
R2915:Ephb6	UTSW	6	41614238	missense	probably damaging	1.00
R3020:Ephb6	UTSW	6	41614521	missense	probably damaging	1.00
R3499:Ephb6	UTSW	6	41616159	nonsense	probably null
R4606:Ephb6	UTSW	6	41616574	missense	probably benign	0.15
R4663:Ephb6	UTSW	6	41617865	missense	probably damaging	1.00
R4668:Ephb6	UTSW	6	41614602	missense	possibly damaging	0.91
R4762:Ephb6	UTSW	6	41618160	missense	probably damaging	0.99
R4767:Ephb6	UTSW	6	41614185	missense	possibly damaging	0.81
R4780:Ephb6	UTSW	6	41616139	missense	probably damaging	1.00
R4846:Ephb6	UTSW	6	41616809	missense	probably benign
R4851:Ephb6	UTSW	6	41618145	missense	probably benign	0.00
R5016:Ephb6	UTSW	6	41618107	missense	probably benign	0.01
R5122:Ephb6	UTSW	6	41613404	missense	probably benign	0.00
R5313:Ephb6	UTSW	6	41616793	missense	possibly damaging	0.68
R5615:Ephb6	UTSW	6	41619291	missense	probably benign
R5623:Ephb6	UTSW	6	41616481	missense	probably benign	0.20
R5686:Ephb6	UTSW	6	41619704	missense	possibly damaging	0.57
R5840:Ephb6	UTSW	6	41615573	missense	possibly damaging	0.94
R6147:Ephb6	UTSW	6	41616781	missense	probably damaging	1.00
R6645:Ephb6	UTSW	6	41617272	missense	probably benign	0.01
R6730:Ephb6	UTSW	6	41617374	nonsense	probably null
R7412:Ephb6	UTSW	6	41620239	missense	probably damaging	1.00
R7442:Ephb6	UTSW	6	41618047	splice site	probably null
R7759:Ephb6	UTSW	6	41614605	missense	probably benign	0.00
R7857:Ephb6	UTSW	6	41613397	missense	probably benign
R8425:Ephb6	UTSW	6	41618646	missense	probably damaging	0.98
R8697:Ephb6	UTSW	6	41614223	missense	probably damaging	0.99
R8898:Ephb6	UTSW	6	41613359	missense	probably benign
R8959:Ephb6	UTSW	6	41613359	missense	probably benign
R8961:Ephb6	UTSW	6	41613359	missense	probably benign
R8980:Ephb6	UTSW	6	41613359	missense	probably benign
R8989:Ephb6	UTSW	6	41613359	missense	probably benign
R8992:Ephb6	UTSW	6	41613359	missense	probably benign
R9065:Ephb6	UTSW	6	41613359	missense	probably benign
R9512:Ephb6	UTSW	6	41616096	missense	possibly damaging	0.70
R9617:Ephb6	UTSW	6	41619324	missense	probably damaging	1.00
R9619:Ephb6	UTSW	6	41617315	missense	possibly damaging	0.72
R9705:Ephb6	UTSW	6	41619781	missense	probably benign	0.05
R9764:Ephb6	UTSW	6	41615977	missense	probably benign	0.01
X0027:Ephb6	UTSW	6	41620080	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TCAAACGCTGGACCAAAGTG -3'
(R):5'- CGCCATTACAGTGTAACCTTGG -3'

Sequencing Primer
(F):5'- CAATTGCCGCAGATGAGAGCTTC -3'
(R):5'- GTTCTGCATGAGCTACAC -3'

Posted On

2022-05-16