Mutagenetix > Incidental Mutation

Incidental Mutation 'R9413:Ap3b2'

711900

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

beta3B, Naptb

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R9413 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81460399-81493925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 81478009 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 140 (P140T)

Ref Sequence

ENSEMBL: ENSMUSP00000080739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]

AlphaFold

Q9JME5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000082090
AA Change: P140T

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: P140T

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000152355
AA Change: P140T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Meta Mutation Damage Score

0.5869

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

97% (35/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,527,199	T1194S	probably benign	Het
Akr7a5	A	T	4: 139,310,748		probably benign	Het
Ap3s1	T	C	18: 46,754,464		probably null	Het
Arrdc2	C	T	8: 70,836,248	R381H	probably damaging	Het
Atg13	T	C	2: 91,681,625	D286G	probably benign	Het
C1qtnf4	T	C	2: 90,890,304	F307S	probably damaging	Het
Cdk5rap1	A	T	2: 154,365,960		probably null	Het
Chsy3	C	T	18: 59,176,098	A141V	possibly damaging	Het
Creb3l1	C	T	2: 91,991,886		probably null	Het
D5Ertd579e	A	G	5: 36,614,934	S706P	probably damaging	Het
Ell2	A	G	13: 75,769,586	D545G		Het
Ephb6	T	C	6: 41,614,575	L222P		Het
Flnc	G	A	6: 29,441,485	R422Q	probably benign	Het
Gm6619	A	T	6: 131,491,407	D167V	unknown	Het
Gucy2c	T	C	6: 136,723,773	D581G	possibly damaging	Het
Hectd1	G	A	12: 51,746,097	R2471*	probably null	Het
Kif1a	A	T	1: 93,021,297	M1501K	probably benign	Het
Mycbpap	A	G	11: 94,501,495	V390A	probably damaging	Het
Olfr136	A	T	17: 38,335,429	T91S	possibly damaging	Het
Pex3	A	G	10: 13,534,710	Y236H	probably damaging	Het
Pglyrp3	G	T	3: 92,022,799	A91S	probably damaging	Het
Ppp1ca	T	C	19: 4,194,898	S292P	probably damaging	Het
Prkci	T	C	3: 31,043,766	V455A	probably damaging	Het
Prrx1	A	G	1: 163,312,613	V8A	probably benign	Het
Psd4	C	T	2: 24,397,460	T468I	probably benign	Het
Rnf213	A	G	11: 119,466,233	E4203G		Het
Snrnp27	T	C	6: 86,676,273	D121G	possibly damaging	Het
Spag6	A	T	2: 18,734,218	M320L	probably benign	Het
Spata16	T	A	3: 26,924,337	M484K	possibly damaging	Het
Trim69	G	A	2: 122,178,602	W381*	probably null	Het
Tubgcp3	A	C	8: 12,624,885	I745S	probably damaging	Het
Ubxn2b	A	G	4: 6,204,607	D156G	probably damaging	Het
Vmn2r103	A	G	17: 19,811,896	N644S	possibly damaging	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81471949	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81476939	splice site	probably benign
IGL01876:Ap3b2	APN	7	81473854	splice site	probably null
IGL02132:Ap3b2	APN	7	81460998	missense	unknown
IGL02227:Ap3b2	APN	7	81473404	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81465698	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81473080	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81463681	splice site	probably null
R0568:Ap3b2	UTSW	7	81464629	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81463911	missense	unknown
R1121:Ap3b2	UTSW	7	81464195	missense	unknown
R1160:Ap3b2	UTSW	7	81466169	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81463690	nonsense	probably null
R1542:Ap3b2	UTSW	7	81478077	splice site	probably null
R1652:Ap3b2	UTSW	7	81473399	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81467599	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81464150	missense	unknown
R2065:Ap3b2	UTSW	7	81463774	missense	unknown
R2353:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81477195	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81478017	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81477136	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81477930	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81476769	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81476752	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81493592	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81473462	nonsense	probably null
R6901:Ap3b2	UTSW	7	81484912	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81477993	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81461009	missense	unknown
R7317:Ap3b2	UTSW	7	81461028	missense	unknown
R7501:Ap3b2	UTSW	7	81473446	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81466146	splice site	probably null
R7643:Ap3b2	UTSW	7	81477072	missense	probably benign	0.24
R7707:Ap3b2	UTSW	7	81476782	missense	possibly damaging	0.60
R8111:Ap3b2	UTSW	7	81463782	missense	unknown
R8273:Ap3b2	UTSW	7	81463242	missense	unknown
R8325:Ap3b2	UTSW	7	81484489	splice site	probably null
R8355:Ap3b2	UTSW	7	81473103	missense	probably damaging	1.00
R8697:Ap3b2	UTSW	7	81473035	missense	possibly damaging	0.91
R8716:Ap3b2	UTSW	7	81477153	missense	probably benign	0.03
R8923:Ap3b2	UTSW	7	81477183	missense	probably benign	0.08
R9002:Ap3b2	UTSW	7	81467444	missense	probably benign	0.02
R9163:Ap3b2	UTSW	7	81463798	missense	unknown
R9304:Ap3b2	UTSW	7	81463271	missense	unknown
R9321:Ap3b2	UTSW	7	81464504	critical splice acceptor site	probably null
R9459:Ap3b2	UTSW	7	81473903	missense	probably benign	0.16
R9746:Ap3b2	UTSW	7	81476344	missense	probably damaging	1.00
X0013:Ap3b2	UTSW	7	81463240	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81463764	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATTCCAGACGAGAAGCAGC -3'
(R):5'- AAGCTAGCCCTTGTCAGGAG -3'

Sequencing Primer
(F):5'- CCTGCAAAACCGTGGTAAGGTC -3'
(R):5'- CTAGCCCTTGTCAGGAGGTAGG -3'

Posted On

2022-05-16