Mutagenetix > Incidental Mutation

Incidental Mutation 'R9413:Tubgcp3'

711902

Institutional Source

Beutler Lab

Gene Symbol

Tubgcp3

Ensembl Gene

ENSMUSG00000000759

Gene Name

tubulin, gamma complex associated protein 3

Synonyms

Spc98p, GCP3

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R9413 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12614277-12672248 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 12624885 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 745 (I745S)

Ref Sequence

ENSEMBL: ENSMUSP00000000776 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000776] [ENSMUST00000164774]

AlphaFold

P58854

Predicted Effect

probably damaging
Transcript: ENSMUST00000000776
AA Change: I745S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000000776
Gene: ENSMUSG00000000759
AA Change: I745S

Domain	Start	End	E-Value	Type
low complexity region	152	171	N/A	INTRINSIC
Pfam:Spc97_Spc98	251	761	9.5e-124	PFAM
coiled coil region	787	814	N/A	INTRINSIC
low complexity region	821	827	N/A	INTRINSIC
low complexity region	890	903	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164774

SMART Domains

Protein: ENSMUSP00000127741
Gene: ENSMUSG00000000759

Domain	Start	End	E-Value	Type
low complexity region	152	171	N/A	INTRINSIC
Pfam:Spc97_Spc98	251	361	3.5e-16	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

97% (35/36)

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,527,199	T1194S	probably benign	Het
Akr7a5	A	T	4: 139,310,748		probably benign	Het
Ap3b2	G	T	7: 81,478,009	P140T	possibly damaging	Het
Ap3s1	T	C	18: 46,754,464		probably null	Het
Arrdc2	C	T	8: 70,836,248	R381H	probably damaging	Het
Atg13	T	C	2: 91,681,625	D286G	probably benign	Het
C1qtnf4	T	C	2: 90,890,304	F307S	probably damaging	Het
Cdk5rap1	A	T	2: 154,365,960		probably null	Het
Chsy3	C	T	18: 59,176,098	A141V	possibly damaging	Het
Creb3l1	C	T	2: 91,991,886		probably null	Het
D5Ertd579e	A	G	5: 36,614,934	S706P	probably damaging	Het
Ell2	A	G	13: 75,769,586	D545G		Het
Ephb6	T	C	6: 41,614,575	L222P		Het
Flnc	G	A	6: 29,441,485	R422Q	probably benign	Het
Gm6619	A	T	6: 131,491,407	D167V	unknown	Het
Gucy2c	T	C	6: 136,723,773	D581G	possibly damaging	Het
Hectd1	G	A	12: 51,746,097	R2471*	probably null	Het
Kif1a	A	T	1: 93,021,297	M1501K	probably benign	Het
Mycbpap	A	G	11: 94,501,495	V390A	probably damaging	Het
Olfr136	A	T	17: 38,335,429	T91S	possibly damaging	Het
Pex3	A	G	10: 13,534,710	Y236H	probably damaging	Het
Pglyrp3	G	T	3: 92,022,799	A91S	probably damaging	Het
Ppp1ca	T	C	19: 4,194,898	S292P	probably damaging	Het
Prkci	T	C	3: 31,043,766	V455A	probably damaging	Het
Prrx1	A	G	1: 163,312,613	V8A	probably benign	Het
Psd4	C	T	2: 24,397,460	T468I	probably benign	Het
Rnf213	A	G	11: 119,466,233	E4203G		Het
Snrnp27	T	C	6: 86,676,273	D121G	possibly damaging	Het
Spag6	A	T	2: 18,734,218	M320L	probably benign	Het
Spata16	T	A	3: 26,924,337	M484K	possibly damaging	Het
Trim69	G	A	2: 122,178,602	W381*	probably null	Het
Ubxn2b	A	G	4: 6,204,607	D156G	probably damaging	Het
Vmn2r103	A	G	17: 19,811,896	N644S	possibly damaging	Het

Other mutations in Tubgcp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Tubgcp3	APN	8	12621809	missense	probably benign	0.00
IGL00583:Tubgcp3	APN	8	12621906	nonsense	probably null
IGL01289:Tubgcp3	APN	8	12639625	missense	probably damaging	1.00
IGL01578:Tubgcp3	APN	8	12661297	splice site	probably benign
IGL01716:Tubgcp3	APN	8	12641094	splice site	probably benign
IGL01943:Tubgcp3	APN	8	12654301	missense	probably damaging	1.00
IGL02020:Tubgcp3	APN	8	12637780	missense	possibly damaging	0.46
IGL02345:Tubgcp3	APN	8	12625056	missense	probably damaging	1.00
IGL02555:Tubgcp3	APN	8	12639595	missense	probably benign	0.36
IGL02644:Tubgcp3	APN	8	12648733	missense	probably damaging	1.00
IGL02976:Tubgcp3	APN	8	12632300	missense	probably damaging	1.00
IGL03240:Tubgcp3	APN	8	12649797	missense	probably benign	0.07
IGL03287:Tubgcp3	APN	8	12639630	missense	possibly damaging	0.77
Tinky_winky	UTSW	8	12650171	missense	probably damaging	1.00
R0145:Tubgcp3	UTSW	8	12657561	missense	probably benign	0.01
R0379:Tubgcp3	UTSW	8	12641116	missense	probably damaging	0.97
R0558:Tubgcp3	UTSW	8	12653462	missense	probably benign	0.00
R1490:Tubgcp3	UTSW	8	12639550	missense	probably damaging	1.00
R1709:Tubgcp3	UTSW	8	12639532	nonsense	probably null
R1768:Tubgcp3	UTSW	8	12649686	unclassified	probably benign
R1921:Tubgcp3	UTSW	8	12621932	nonsense	probably null
R1928:Tubgcp3	UTSW	8	12663988	missense	possibly damaging	0.94
R2161:Tubgcp3	UTSW	8	12632292	missense	probably benign	0.22
R3120:Tubgcp3	UTSW	8	12657626	missense	possibly damaging	0.51
R3434:Tubgcp3	UTSW	8	12658381	splice site	probably null
R4011:Tubgcp3	UTSW	8	12639634	nonsense	probably null
R4162:Tubgcp3	UTSW	8	12639547	missense	possibly damaging	0.46
R4300:Tubgcp3	UTSW	8	12657600	missense	probably damaging	0.99
R4350:Tubgcp3	UTSW	8	12641117	missense	probably benign	0.19
R4529:Tubgcp3	UTSW	8	12663932	missense	probably damaging	0.98
R4530:Tubgcp3	UTSW	8	12663932	missense	probably damaging	0.98
R4531:Tubgcp3	UTSW	8	12663932	missense	probably damaging	0.98
R4676:Tubgcp3	UTSW	8	12650171	missense	probably damaging	1.00
R4730:Tubgcp3	UTSW	8	12657654	missense	probably benign	0.03
R4828:Tubgcp3	UTSW	8	12671987	missense	probably benign
R4860:Tubgcp3	UTSW	8	12649722	missense	probably benign	0.03
R4860:Tubgcp3	UTSW	8	12649722	missense	probably benign	0.03
R5610:Tubgcp3	UTSW	8	12639577	missense	probably damaging	1.00
R5625:Tubgcp3	UTSW	8	12624888	missense	possibly damaging	0.46
R5650:Tubgcp3	UTSW	8	12648670	missense	probably damaging	0.98
R5775:Tubgcp3	UTSW	8	12625056	missense	probably damaging	1.00
R6257:Tubgcp3	UTSW	8	12649835	splice site	probably null
R6314:Tubgcp3	UTSW	8	12648625	missense	probably benign	0.02
R6970:Tubgcp3	UTSW	8	12637000	missense	probably damaging	0.98
R7173:Tubgcp3	UTSW	8	12639259	splice site	probably null
R7408:Tubgcp3	UTSW	8	12661359	nonsense	probably null
R7502:Tubgcp3	UTSW	8	12641207	missense	probably damaging	0.99
R7701:Tubgcp3	UTSW	8	12655974	missense	probably benign
R7739:Tubgcp3	UTSW	8	12657561	missense	probably benign	0.01
R8169:Tubgcp3	UTSW	8	12616099	missense	probably benign
R8327:Tubgcp3	UTSW	8	12654343	missense	probably benign	0.11
R8723:Tubgcp3	UTSW	8	12621899	missense	probably damaging	0.96
R9212:Tubgcp3	UTSW	8	12641200	missense	possibly damaging	0.67
R9393:Tubgcp3	UTSW	8	12653411	missense	probably damaging	1.00
R9650:Tubgcp3	UTSW	8	12655974	missense	probably benign
R9739:Tubgcp3	UTSW	8	12649744	missense	probably benign	0.06
R9748:Tubgcp3	UTSW	8	12649758	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAAACTTATGCAGCCCCGTGC -3'
(R):5'- GAGATGGTGCACTTCATCCAC -3'

Sequencing Primer
(F):5'- CGTGCCATTAACTGACTAAGACAATG -3'
(R):5'- CCAGATGCAGTACTACATCACCTTTG -3'

Posted On

2022-05-16