Incidental Mutation 'R9413:Olfr136'
ID 711910
Institutional Source Beutler Lab
Gene Symbol Olfr136
Ensembl Gene ENSMUSG00000096840
Gene Name olfactory receptor 136
Synonyms GA_x6K02T2PSCP-2779375-2780313, MOR256-7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock # R9413 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 38329831-38336643 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 38335429 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 91 (T91S)
Ref Sequence ENSEMBL: ENSMUSP00000146828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077203] [ENSMUST00000208525] [ENSMUST00000208539] [ENSMUST00000214035] [ENSMUST00000216963]
AlphaFold Q8VG72
Predicted Effect possibly damaging
Transcript: ENSMUST00000077203
AA Change: T91S

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076443
Gene: ENSMUSG00000096840
AA Change: T91S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-48 PFAM
Pfam:7tm_1 41 290 7.1e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000208525
AA Change: T91S

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208539
AA Change: T91S

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214035
AA Change: T91S

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216963
AA Change: T91S

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,199 T1194S probably benign Het
Akr7a5 A T 4: 139,310,748 probably benign Het
Ap3b2 G T 7: 81,478,009 P140T possibly damaging Het
Ap3s1 T C 18: 46,754,464 probably null Het
Arrdc2 C T 8: 70,836,248 R381H probably damaging Het
Atg13 T C 2: 91,681,625 D286G probably benign Het
C1qtnf4 T C 2: 90,890,304 F307S probably damaging Het
Cdk5rap1 A T 2: 154,365,960 probably null Het
Chsy3 C T 18: 59,176,098 A141V possibly damaging Het
Creb3l1 C T 2: 91,991,886 probably null Het
D5Ertd579e A G 5: 36,614,934 S706P probably damaging Het
Ell2 A G 13: 75,769,586 D545G Het
Ephb6 T C 6: 41,614,575 L222P Het
Flnc G A 6: 29,441,485 R422Q probably benign Het
Gm6619 A T 6: 131,491,407 D167V unknown Het
Gucy2c T C 6: 136,723,773 D581G possibly damaging Het
Hectd1 G A 12: 51,746,097 R2471* probably null Het
Kif1a A T 1: 93,021,297 M1501K probably benign Het
Mycbpap A G 11: 94,501,495 V390A probably damaging Het
Pex3 A G 10: 13,534,710 Y236H probably damaging Het
Pglyrp3 G T 3: 92,022,799 A91S probably damaging Het
Ppp1ca T C 19: 4,194,898 S292P probably damaging Het
Prkci T C 3: 31,043,766 V455A probably damaging Het
Prrx1 A G 1: 163,312,613 V8A probably benign Het
Psd4 C T 2: 24,397,460 T468I probably benign Het
Rnf213 A G 11: 119,466,233 E4203G Het
Snrnp27 T C 6: 86,676,273 D121G possibly damaging Het
Spag6 A T 2: 18,734,218 M320L probably benign Het
Spata16 T A 3: 26,924,337 M484K possibly damaging Het
Trim69 G A 2: 122,178,602 W381* probably null Het
Tubgcp3 A C 8: 12,624,885 I745S probably damaging Het
Ubxn2b A G 4: 6,204,607 D156G probably damaging Het
Vmn2r103 A G 17: 19,811,896 N644S possibly damaging Het
Other mutations in Olfr136
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Olfr136 APN 17 38335957 missense probably benign 0.00
IGL01787:Olfr136 APN 17 38335579 missense probably damaging 0.98
IGL02480:Olfr136 APN 17 38335423 missense probably benign 0.32
IGL02603:Olfr136 APN 17 38335513 missense probably damaging 1.00
IGL03122:Olfr136 APN 17 38335301 missense probably benign 0.01
BB009:Olfr136 UTSW 17 38335255 missense probably benign 0.01
BB019:Olfr136 UTSW 17 38335255 missense probably benign 0.01
R0295:Olfr136 UTSW 17 38335291 missense probably damaging 1.00
R0684:Olfr136 UTSW 17 38335844 missense probably benign 0.11
R1874:Olfr136 UTSW 17 38335969 missense probably damaging 1.00
R3436:Olfr136 UTSW 17 38335432 missense probably damaging 1.00
R3437:Olfr136 UTSW 17 38335432 missense probably damaging 1.00
R4714:Olfr136 UTSW 17 38335840 missense possibly damaging 0.65
R4715:Olfr136 UTSW 17 38335840 missense possibly damaging 0.65
R4716:Olfr136 UTSW 17 38335840 missense possibly damaging 0.65
R4878:Olfr136 UTSW 17 38335627 missense probably benign
R5296:Olfr136 UTSW 17 38335456 nonsense probably null
R5370:Olfr136 UTSW 17 38335444 nonsense probably null
R5413:Olfr136 UTSW 17 38335624 missense probably benign 0.03
R5988:Olfr136 UTSW 17 38336020 missense probably damaging 1.00
R6156:Olfr136 UTSW 17 38335173 missense probably damaging 0.99
R6550:Olfr136 UTSW 17 38336005 missense possibly damaging 0.65
R7395:Olfr136 UTSW 17 38335864 nonsense probably null
R7417:Olfr136 UTSW 17 38335292 missense probably damaging 1.00
R7746:Olfr136 UTSW 17 38335394 missense probably benign 0.16
R7747:Olfr136 UTSW 17 38335394 missense probably benign 0.16
R7821:Olfr136 UTSW 17 38335964 missense probably benign 0.13
R7932:Olfr136 UTSW 17 38335255 missense probably benign 0.01
R8409:Olfr136 UTSW 17 38335306 missense probably benign 0.09
R8911:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R8912:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R8913:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R8914:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R8968:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R9006:Olfr136 UTSW 17 38335832 missense possibly damaging 0.84
R9044:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R9110:Olfr136 UTSW 17 38335543 missense probably damaging 1.00
R9155:Olfr136 UTSW 17 38335333 missense probably damaging 0.99
R9279:Olfr136 UTSW 17 38335523 missense probably damaging 0.99
R9289:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R9295:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R9317:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R9318:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R9348:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R9409:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R9410:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R9411:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R9412:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R9512:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R9522:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
R9524:Olfr136 UTSW 17 38335649 nonsense probably null
R9547:Olfr136 UTSW 17 38335450 missense possibly damaging 0.80
R9580:Olfr136 UTSW 17 38335429 missense possibly damaging 0.94
V5088:Olfr136 UTSW 17 38335159 start codon destroyed probably null 0.99
Z1176:Olfr136 UTSW 17 38335352 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTTTGCTAACCATCCTTG -3'
(R):5'- GCAAAGATCACGCCAGTCAG -3'

Sequencing Primer
(F):5'- ACTCTTCTGATAACATATCCCATGG -3'
(R):5'- CGCCAGTCAGCCACATAATAG -3'
Posted On 2022-05-16