Incidental Mutation 'R9413:Chsy3'
ID 711912
Institutional Source Beutler Lab
Gene Symbol Chsy3
Ensembl Gene ENSMUSG00000058152
Gene Name chondroitin sulfate synthase 3
Synonyms 4833446K15Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001081328.1; MGI:1926173
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9413 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 59175401-59410446 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 59176098 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 141 (A141V)
Ref Sequence ENSEMBL: ENSMUSP00000079546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080721]
AlphaFold Q5DTK1
Predicted Effect possibly damaging
Transcript: ENSMUST00000080721
AA Change: A141V

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000079546
Gene: ENSMUSG00000058152
AA Change: A141V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 84 96 N/A INTRINSIC
low complexity region 125 144 N/A INTRINSIC
Pfam:Fringe 169 410 9.4e-19 PFAM
Pfam:CHGN 330 866 1.4e-194 PFAM
Pfam:Glyco_tranf_2_2 652 841 1.8e-7 PFAM
Pfam:Glyco_transf_7C 769 839 3.2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CSS3 is a glycosyltransferase that has both glucuronyltransferase and N-acetylgalactosaminyltransferase activities (Yada et al., 2003 [PubMed 12907687]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1)
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,199 T1194S probably benign Het
Akr7a5 A T 4: 139,310,748 probably benign Het
Ap3b2 G T 7: 81,478,009 P140T possibly damaging Het
Ap3s1 T C 18: 46,754,464 probably null Het
Arrdc2 C T 8: 70,836,248 R381H probably damaging Het
Atg13 T C 2: 91,681,625 D286G probably benign Het
C1qtnf4 T C 2: 90,890,304 F307S probably damaging Het
Cdk5rap1 A T 2: 154,365,960 probably null Het
Creb3l1 C T 2: 91,991,886 probably null Het
D5Ertd579e A G 5: 36,614,934 S706P probably damaging Het
Ell2 A G 13: 75,769,586 D545G Het
Ephb6 T C 6: 41,614,575 L222P Het
Flnc G A 6: 29,441,485 R422Q probably benign Het
Gm6619 A T 6: 131,491,407 D167V unknown Het
Gucy2c T C 6: 136,723,773 D581G possibly damaging Het
Hectd1 G A 12: 51,746,097 R2471* probably null Het
Kif1a A T 1: 93,021,297 M1501K probably benign Het
Mycbpap A G 11: 94,501,495 V390A probably damaging Het
Olfr136 A T 17: 38,335,429 T91S possibly damaging Het
Pex3 A G 10: 13,534,710 Y236H probably damaging Het
Pglyrp3 G T 3: 92,022,799 A91S probably damaging Het
Ppp1ca T C 19: 4,194,898 S292P probably damaging Het
Prkci T C 3: 31,043,766 V455A probably damaging Het
Prrx1 A G 1: 163,312,613 V8A probably benign Het
Psd4 C T 2: 24,397,460 T468I probably benign Het
Rnf213 A G 11: 119,466,233 E4203G Het
Snrnp27 T C 6: 86,676,273 D121G possibly damaging Het
Spag6 A T 2: 18,734,218 M320L probably benign Het
Spata16 T A 3: 26,924,337 M484K possibly damaging Het
Trim69 G A 2: 122,178,602 W381* probably null Het
Tubgcp3 A C 8: 12,624,885 I745S probably damaging Het
Ubxn2b A G 4: 6,204,607 D156G probably damaging Het
Vmn2r103 A G 17: 19,811,896 N644S possibly damaging Het
Other mutations in Chsy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Chsy3 APN 18 59176367 missense probably damaging 1.00
IGL01543:Chsy3 APN 18 59410400 nonsense probably null
IGL01627:Chsy3 APN 18 59176295 missense probably damaging 1.00
IGL02232:Chsy3 APN 18 59409311 missense possibly damaging 0.89
IGL02604:Chsy3 APN 18 59409115 missense probably benign 0.00
IGL02888:Chsy3 APN 18 59409995 missense probably benign 0.00
IGL03199:Chsy3 APN 18 59176401 missense probably damaging 1.00
bajo UTSW 18 59176166 frame shift probably null
bajo2 UTSW 18 59176419 missense probably damaging 1.00
inferior UTSW 18 59176415 missense probably damaging 1.00
P0045:Chsy3 UTSW 18 59409006 nonsense probably null
R0456:Chsy3 UTSW 18 59176478 missense probably damaging 1.00
R0605:Chsy3 UTSW 18 59409053 missense probably damaging 0.97
R1068:Chsy3 UTSW 18 59410289 missense probably damaging 1.00
R1479:Chsy3 UTSW 18 59408913 missense probably benign 0.09
R1654:Chsy3 UTSW 18 59176416 missense probably damaging 1.00
R1868:Chsy3 UTSW 18 59176488 splice site probably null
R1938:Chsy3 UTSW 18 59409512 missense probably damaging 1.00
R2114:Chsy3 UTSW 18 59179489 missense probably damaging 1.00
R2146:Chsy3 UTSW 18 59176472 missense probably benign 0.04
R3693:Chsy3 UTSW 18 59176008 missense possibly damaging 0.88
R3787:Chsy3 UTSW 18 59408998 missense probably damaging 1.00
R3811:Chsy3 UTSW 18 59176170 missense probably benign 0.42
R3878:Chsy3 UTSW 18 59409773 missense probably damaging 1.00
R4385:Chsy3 UTSW 18 59176352 missense probably benign 0.00
R4385:Chsy3 UTSW 18 59179474 missense possibly damaging 0.95
R4512:Chsy3 UTSW 18 59410187 missense probably damaging 1.00
R4734:Chsy3 UTSW 18 59179413 missense probably benign 0.07
R4751:Chsy3 UTSW 18 59175800 missense possibly damaging 0.66
R4982:Chsy3 UTSW 18 59409575 missense probably benign 0.07
R4982:Chsy3 UTSW 18 59409767 missense possibly damaging 0.78
R5032:Chsy3 UTSW 18 59179471 missense probably damaging 1.00
R5088:Chsy3 UTSW 18 59179535 missense probably damaging 1.00
R5220:Chsy3 UTSW 18 59410030 missense probably damaging 0.99
R5257:Chsy3 UTSW 18 59409794 missense possibly damaging 0.50
R5259:Chsy3 UTSW 18 59410246 missense probably damaging 0.96
R5558:Chsy3 UTSW 18 59176397 missense probably damaging 1.00
R5872:Chsy3 UTSW 18 59176196 missense probably damaging 1.00
R5990:Chsy3 UTSW 18 59176166 frame shift probably null
R5992:Chsy3 UTSW 18 59176166 frame shift probably null
R6064:Chsy3 UTSW 18 59176166 frame shift probably null
R6065:Chsy3 UTSW 18 59176166 frame shift probably null
R6182:Chsy3 UTSW 18 59179342 missense probably benign 0.00
R6881:Chsy3 UTSW 18 59179408 missense probably damaging 1.00
R6985:Chsy3 UTSW 18 59176488 splice site probably null
R7046:Chsy3 UTSW 18 59409803 missense probably benign 0.00
R7078:Chsy3 UTSW 18 59176077 missense possibly damaging 0.51
R7105:Chsy3 UTSW 18 59176419 missense probably damaging 1.00
R7129:Chsy3 UTSW 18 59410298 missense probably damaging 1.00
R7151:Chsy3 UTSW 18 59409285 missense possibly damaging 0.55
R7224:Chsy3 UTSW 18 59408975 missense probably damaging 1.00
R7860:Chsy3 UTSW 18 59409227 missense probably benign 0.10
R7936:Chsy3 UTSW 18 59409346 missense probably damaging 1.00
R8010:Chsy3 UTSW 18 59410154 missense probably damaging 1.00
R8029:Chsy3 UTSW 18 59179447 missense possibly damaging 0.87
R8215:Chsy3 UTSW 18 59175869 nonsense probably null
R8332:Chsy3 UTSW 18 59409015 missense probably damaging 0.98
R8375:Chsy3 UTSW 18 59179513 missense probably damaging 1.00
R8560:Chsy3 UTSW 18 59410058 missense possibly damaging 0.91
R8700:Chsy3 UTSW 18 59176415 missense probably damaging 1.00
R9040:Chsy3 UTSW 18 59409688 missense probably damaging 0.98
R9290:Chsy3 UTSW 18 59409856 missense probably benign 0.00
R9490:Chsy3 UTSW 18 59179414 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGCGGCTCCAGTCTTTG -3'
(R):5'- CTGGAAAAGAACTCCACGCG -3'

Sequencing Primer
(F):5'- TGCTCCTACTACGGCCG -3'
(R):5'- AGAACTCCACGCGGCCAG -3'
Posted On 2022-05-16