Incidental Mutation 'R9414:Rp1'
ID 711914
Institutional Source Beutler Lab
Gene Symbol Rp1
Ensembl Gene ENSMUSG00000025900
Gene Name retinitis pigmentosa 1 (human)
Synonyms Dcdc3, mG145, Orp1, oxygen-regulated protein 1, Rp1h
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R9414 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 3999557-4409241 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 4243618 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 507 (W507R)
Ref Sequence ENSEMBL: ENSMUSP00000146439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208660]
AlphaFold P56716
Predicted Effect unknown
Transcript: ENSMUST00000208660
AA Change: W507R
Meta Mutation Damage Score 0.1079 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,144,274 I689K probably damaging Het
Agtpbp1 G T 13: 59,462,088 T1076K probably damaging Het
Ammecr1l A G 18: 31,771,909 T68A probably benign Het
Arvcf A G 16: 18,397,715 E264G probably damaging Het
Cacna1b C T 2: 24,648,502 D1542N probably damaging Het
Cacna2d2 A G 9: 107,515,196 T512A probably damaging Het
Crebbp A G 16: 4,107,492 C1213R probably damaging Het
Cybrd1 G T 2: 71,118,223 R35L probably damaging Het
Dcaf1 G A 9: 106,879,959 W1412* probably null Het
Eif4e T A 3: 138,547,734 D67E probably benign Het
Epb41 G A 4: 131,974,851 T491I probably damaging Het
Fez1 G A 9: 36,867,951 S308N probably benign Het
Fgfr3 A G 5: 33,729,954 S206G possibly damaging Het
Flcn A T 11: 59,794,172 N484K possibly damaging Het
Gdap2 T C 3: 100,182,755 probably null Het
Gfpt1 T A 6: 87,085,283 D541E probably benign Het
Gm38394 T C 1: 133,657,277 D774G probably damaging Het
Gm5089 A G 14: 122,436,192 F39S unknown Het
Gm7694 C T 1: 170,302,604 G75D probably benign Het
Gpr15 A G 16: 58,718,153 L191S probably benign Het
Hmcn1 T G 1: 150,669,436 T2807P probably damaging Het
Iqgap2 T C 13: 95,646,841 T1276A Het
Itgae G T 11: 73,111,803 A129S possibly damaging Het
Kcns1 T C 2: 164,168,458 E127G probably damaging Het
Kmt2b T C 7: 30,582,882 E1118G probably damaging Het
Lair1 T C 7: 4,010,820 I143V probably benign Het
Lcmt2 T C 2: 121,140,140 D154G possibly damaging Het
Ly9 T C 1: 171,599,707 T427A probably damaging Het
Man2c1 A G 9: 57,136,746 T281A possibly damaging Het
Map4k2 T C 19: 6,344,485 F332L probably benign Het
Mmp10 A T 9: 7,502,488 D32V probably benign Het
Mroh2a C T 1: 88,251,374 R1110W probably benign Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Npnt T C 3: 132,906,355 N300S probably benign Het
Olfr1443 T C 19: 12,680,348 V80A probably benign Het
Olfr178 G A 16: 58,890,202 T6I probably benign Het
Olfr53 C A 7: 140,652,350 R124S probably damaging Het
Pacsin1 T C 17: 27,708,011 V387A probably damaging Het
Pald1 G T 10: 61,343,153 A489E probably benign Het
Pcnx G T 12: 81,918,204 G382W probably damaging Het
Pde6b T A 5: 108,419,726 M294K possibly damaging Het
Phf20 T C 2: 156,294,247 V662A probably benign Het
Plcg1 T C 2: 160,761,356 I1149T possibly damaging Het
Prdx2 T C 8: 84,970,567 S79P probably damaging Het
Rab19 T C 6: 39,383,921 M1T probably null Het
Retn T G 8: 3,656,908 F44C probably damaging Het
Rsf1 A C 7: 97,664,558 probably null Het
Ryr3 C T 2: 112,670,666 E3561K possibly damaging Het
Scaf1 T A 7: 45,003,292 Y1220F unknown Het
Sowahc A G 10: 59,222,669 K209R probably benign Het
Supt20 T A 3: 54,703,083 I103N probably damaging Het
Tenm4 A G 7: 96,896,160 E2498G probably benign Het
Tet1 T C 10: 62,839,156 N1047S probably benign Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tldc1 A T 8: 119,768,342 S226T probably benign Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Uggt1 T C 1: 36,184,426 E594G probably benign Het
Vmn2r104 T A 17: 20,029,988 I674F probably damaging Het
Zcchc4 T C 5: 52,796,622 S215P probably benign Het
Zfc3h1 T G 10: 115,414,011 S1177A possibly damaging Het
Zfp646 G A 7: 127,881,878 A1076T probably damaging Het
Zfp735 T A 11: 73,711,197 Y322* probably null Het
Other mutations in Rp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rp1 APN 1 4346746 missense probably damaging 0.98
IGL00593:Rp1 APN 1 4345403 missense possibly damaging 0.70
IGL00956:Rp1 APN 1 4352212 missense probably damaging 1.00
IGL01070:Rp1 APN 1 4345238 missense probably damaging 1.00
IGL01531:Rp1 APN 1 4348945 missense probably benign 0.00
IGL01668:Rp1 APN 1 4345718 missense probably damaging 1.00
IGL01907:Rp1 APN 1 4348507 missense possibly damaging 0.56
IGL02055:Rp1 APN 1 4352522 missense probably damaging 1.00
IGL02071:Rp1 APN 1 4345310 missense possibly damaging 0.46
IGL02128:Rp1 APN 1 4347385 missense probably damaging 0.99
IGL02244:Rp1 APN 1 4348780 missense probably benign 0.00
IGL02381:Rp1 APN 1 4352390 missense probably benign 0.01
IGL02499:Rp1 APN 1 4349048 missense probably benign 0.17
IGL02619:Rp1 APN 1 4348450 missense possibly damaging 0.73
IGL02832:Rp1 APN 1 4349713 missense probably benign 0.03
IGL02861:Rp1 APN 1 4346152 nonsense probably null
IGL03288:Rp1 APN 1 4349524 missense possibly damaging 0.88
IGL03290:Rp1 APN 1 4350041 missense probably damaging 1.00
IGL03303:Rp1 APN 1 4344817 missense probably damaging 1.00
R0041:Rp1 UTSW 1 4344628 missense probably benign 0.36
R0111:Rp1 UTSW 1 4344760 missense probably damaging 1.00
R0363:Rp1 UTSW 1 4347718 missense probably damaging 1.00
R0440:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R0442:Rp1 UTSW 1 4346747 missense probably benign 0.09
R0528:Rp1 UTSW 1 4344865 missense possibly damaging 0.82
R0586:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R0639:Rp1 UTSW 1 4346498 missense probably benign 0.00
R0856:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0908:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0968:Rp1 UTSW 1 4345352 missense probably benign 0.00
R1099:Rp1 UTSW 1 4352290 missense possibly damaging 0.45
R1242:Rp1 UTSW 1 4344962 missense probably benign 0.03
R1301:Rp1 UTSW 1 4345936 missense possibly damaging 0.56
R1327:Rp1 UTSW 1 4347970 missense probably benign 0.01
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1440:Rp1 UTSW 1 4347396 missense probably damaging 1.00
R1509:Rp1 UTSW 1 4347694 missense probably damaging 0.98
R1509:Rp1 UTSW 1 4348537 missense probably benign 0.20
R1538:Rp1 UTSW 1 4345676 missense probably damaging 1.00
R1609:Rp1 UTSW 1 4349201 missense probably damaging 1.00
R1666:Rp1 UTSW 1 4349863 missense probably damaging 1.00
R1703:Rp1 UTSW 1 4345169 missense probably damaging 1.00
R1782:Rp1 UTSW 1 4349089 missense probably benign 0.00
R1799:Rp1 UTSW 1 4348832 missense possibly damaging 0.94
R1848:Rp1 UTSW 1 4347232 missense possibly damaging 0.76
R1908:Rp1 UTSW 1 4348720 missense probably damaging 0.99
R1919:Rp1 UTSW 1 4352671 missense probably damaging 0.99
R2087:Rp1 UTSW 1 4348352 missense probably damaging 1.00
R2211:Rp1 UTSW 1 4348139 missense probably damaging 0.96
R2278:Rp1 UTSW 1 4348027 missense possibly damaging 0.51
R2287:Rp1 UTSW 1 4345959 nonsense probably null
R2316:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R2346:Rp1 UTSW 1 4348013 missense probably damaging 1.00
R2878:Rp1 UTSW 1 4348139 missense probably damaging 1.00
R3023:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3025:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3716:Rp1 UTSW 1 4349765 missense probably benign 0.38
R3814:Rp1 UTSW 1 4349708 missense probably benign
R3929:Rp1 UTSW 1 4352645 missense probably damaging 1.00
R4064:Rp1 UTSW 1 4345400 missense probably benign 0.08
R4426:Rp1 UTSW 1 4347924 missense probably benign 0.13
R4557:Rp1 UTSW 1 4344663 missense possibly damaging 0.61
R4764:Rp1 UTSW 1 4345878 missense probably damaging 0.96
R4845:Rp1 UTSW 1 4349228 missense probably benign 0.02
R4850:Rp1 UTSW 1 4348675 missense probably damaging 1.00
R4857:Rp1 UTSW 1 4352316 missense probably damaging 0.99
R4857:Rp1 UTSW 1 4352317 missense probably damaging 1.00
R5159:Rp1 UTSW 1 4346203 missense possibly damaging 0.73
R5226:Rp1 UTSW 1 4348033 missense probably benign 0.01
R5327:Rp1 UTSW 1 4349360 splice site probably null
R5352:Rp1 UTSW 1 4347098 missense probably benign 0.00
R5504:Rp1 UTSW 1 4349890 missense probably damaging 1.00
R5527:Rp1 UTSW 1 4346393 missense possibly damaging 0.75
R5529:Rp1 UTSW 1 4345832 missense probably benign 0.42
R5569:Rp1 UTSW 1 4345237 missense probably damaging 1.00
R5622:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R5970:Rp1 UTSW 1 4348462 missense probably benign 0.05
R5992:Rp1 UTSW 1 4148703 missense unknown
R6004:Rp1 UTSW 1 4197585 missense unknown
R6018:Rp1 UTSW 1 4352836 missense possibly damaging 0.83
R6074:Rp1 UTSW 1 4345379 missense probably benign 0.02
R6127:Rp1 UTSW 1 4349311 missense possibly damaging 0.80
R6187:Rp1 UTSW 1 4349869 missense probably damaging 1.00
R6301:Rp1 UTSW 1 4347254 missense probably benign 0.04
R6317:Rp1 UTSW 1 4041989 missense unknown
R6405:Rp1 UTSW 1 4345771 missense probably damaging 1.00
R6445:Rp1 UTSW 1 4226617 missense unknown
R6466:Rp1 UTSW 1 4347886 missense probably benign 0.01
R6501:Rp1 UTSW 1 4311280 intron probably benign
R6547:Rp1 UTSW 1 4170305 missense unknown
R6604:Rp1 UTSW 1 4019128 missense unknown
R6700:Rp1 UTSW 1 4349896 missense probably damaging 1.00
R6706:Rp1 UTSW 1 4142664 missense unknown
R6831:Rp1 UTSW 1 4349864 splice site probably null
R6918:Rp1 UTSW 1 3999608 missense unknown
R6973:Rp1 UTSW 1 4351994 nonsense probably null
R6981:Rp1 UTSW 1 4345655 missense probably benign 0.06
R7009:Rp1 UTSW 1 4042068 missense unknown
R7078:Rp1 UTSW 1 4206791 missense unknown
R7112:Rp1 UTSW 1 4349018 missense probably benign 0.43
R7135:Rp1 UTSW 1 4348168 missense possibly damaging 0.83
R7165:Rp1 UTSW 1 4349917 missense probably damaging 0.99
R7199:Rp1 UTSW 1 4347290 missense possibly damaging 0.73
R7232:Rp1 UTSW 1 4228601 missense unknown
R7367:Rp1 UTSW 1 4347998 missense probably benign 0.42
R7484:Rp1 UTSW 1 4345481 missense probably benign 0.10
R7500:Rp1 UTSW 1 4311278 missense unknown
R7569:Rp1 UTSW 1 4284840 missense unknown
R7642:Rp1 UTSW 1 4147831 missense unknown
R7693:Rp1 UTSW 1 4347403 missense probably damaging 1.00
R7742:Rp1 UTSW 1 4170234 missense unknown
R7759:Rp1 UTSW 1 4344884 missense probably benign
R7784:Rp1 UTSW 1 4142658 missense unknown
R7816:Rp1 UTSW 1 4347703 missense probably damaging 0.98
R7866:Rp1 UTSW 1 4347701 missense probably benign 0.02
R8215:Rp1 UTSW 1 4245095 missense unknown
R8281:Rp1 UTSW 1 4347916 missense probably damaging 1.00
R8294:Rp1 UTSW 1 4345997 missense probably benign 0.09
R8309:Rp1 UTSW 1 4347089 missense probably benign 0.00
R8311:Rp1 UTSW 1 4348349 missense probably benign 0.11
R8500:Rp1 UTSW 1 4346590 missense possibly damaging 0.91
R8559:Rp1 UTSW 1 4349561 missense probably damaging 1.00
R8672:Rp1 UTSW 1 4348784 missense possibly damaging 0.55
R8688:Rp1 UTSW 1 4346405 missense probably benign 0.01
R8792:Rp1 UTSW 1 4024868 missense unknown
R8859:Rp1 UTSW 1 4349960 missense probably benign 0.07
R8945:Rp1 UTSW 1 4349594 missense probably benign 0.42
R8959:Rp1 UTSW 1 4349427 intron probably benign
R8979:Rp1 UTSW 1 4148714 missense unknown
R9126:Rp1 UTSW 1 4346913 missense probably damaging 0.99
R9156:Rp1 UTSW 1 4163938 missense unknown
R9160:Rp1 UTSW 1 4346497 missense probably benign 0.00
R9221:Rp1 UTSW 1 4245043 missense unknown
R9263:Rp1 UTSW 1 4348452 missense probably benign 0.25
R9263:Rp1 UTSW 1 4348937 missense probably benign 0.02
R9302:Rp1 UTSW 1 4346566 missense probably damaging 1.00
R9318:Rp1 UTSW 1 4348265 missense probably benign 0.09
R9474:Rp1 UTSW 1 4092615 critical splice donor site probably null
R9478:Rp1 UTSW 1 4347322 missense probably benign 0.06
R9529:Rp1 UTSW 1 4346224 missense probably benign
R9572:Rp1 UTSW 1 4348439 missense probably benign
R9673:Rp1 UTSW 1 4267569 missense unknown
R9709:Rp1 UTSW 1 4042032 missense unknown
R9716:Rp1 UTSW 1 4142610 critical splice donor site probably null
RF003:Rp1 UTSW 1 4344694 missense probably damaging 0.99
V1662:Rp1 UTSW 1 4349560 missense probably damaging 1.00
X0012:Rp1 UTSW 1 4347695 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTTCTTTCCTGGAAATATAAAGGGG -3'
(R):5'- GCTGTGGATTGAAGAAAACACTCAG -3'

Sequencing Primer
(F):5'- AGGGGAAGTTGATTCATTTCAAG -3'
(R):5'- GAAAACACTCAGTCTTTCACCCTTG -3'
Posted On 2022-05-16