Mutagenetix > Incidental Mutation

Incidental Mutation 'R9414:Supt20'

711927

Institutional Source

Beutler Lab

Gene Symbol

Supt20

Ensembl Gene

ENSMUSG00000027751

Gene Name

suppressor of Ty 20

Synonyms

Fam48a, p38IP, D3Ertd300e, p38 interacting protein

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.925) question?

Stock #

R9414 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

54692807-54728766 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 54703083 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 103 (I103N)

Ref Sequence

ENSEMBL: ENSMUSP00000131454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029315] [ENSMUST00000170552] [ENSMUST00000197502] [ENSMUST00000199652] [ENSMUST00000199655] [ENSMUST00000199674] [ENSMUST00000200439] [ENSMUST00000200441]

AlphaFold

Q7TT00

Predicted Effect

probably benign
Transcript: ENSMUST00000029315

SMART Domains

Protein: ENSMUSP00000029315
Gene: ENSMUSG00000027751

Domain	Start	End	E-Value	Type
low complexity region	65	78	N/A	INTRINSIC
low complexity region	107	159	N/A	INTRINSIC
coiled coil region	201	230	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000170552
AA Change: I103N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000131454
Gene: ENSMUSG00000027751
AA Change: I103N

Domain	Start	End	E-Value	Type
Pfam:Spt20	63	229	6.8e-47	PFAM
low complexity region	425	441	N/A	INTRINSIC
low complexity region	468	477	N/A	INTRINSIC
low complexity region	488	502	N/A	INTRINSIC
low complexity region	515	526	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000197502
AA Change: I102N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143750
Gene: ENSMUSG00000027751
AA Change: I102N

Domain	Start	End	E-Value	Type
low complexity region	45	56	N/A	INTRINSIC
Pfam:Spt20	62	227	1.9e-43	PFAM
low complexity region	424	440	N/A	INTRINSIC
low complexity region	467	476	N/A	INTRINSIC
low complexity region	487	501	N/A	INTRINSIC
low complexity region	512	532	N/A	INTRINSIC
low complexity region	574	587	N/A	INTRINSIC
low complexity region	632	680	N/A	INTRINSIC
coiled coil region	722	751	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000199652
AA Change: I102N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000142648
Gene: ENSMUSG00000027751
AA Change: I102N

Domain	Start	End	E-Value	Type
low complexity region	45	56	N/A	INTRINSIC
Pfam:Spt20	59	181	1.2e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000199655
AA Change: I102N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000143520
Gene: ENSMUSG00000027751
AA Change: I102N

Domain	Start	End	E-Value	Type
low complexity region	45	56	N/A	INTRINSIC
Pfam:Spt20	62	140	5.3e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000199674
AA Change: I102N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000142948
Gene: ENSMUSG00000027751
AA Change: I102N

Domain	Start	End	E-Value	Type
low complexity region	45	56	N/A	INTRINSIC
Pfam:Spt20	59	227	3.3e-39	PFAM
low complexity region	424	442	N/A	INTRINSIC
low complexity region	466	475	N/A	INTRINSIC
low complexity region	486	500	N/A	INTRINSIC
low complexity region	513	524	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200439
AA Change: I102N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000143059
Gene: ENSMUSG00000027751
AA Change: I102N

Domain	Start	End	E-Value	Type
low complexity region	45	56	N/A	INTRINSIC
Pfam:Spt20	59	227	2.7e-42	PFAM
low complexity region	424	440	N/A	INTRINSIC
low complexity region	467	476	N/A	INTRINSIC
low complexity region	487	501	N/A	INTRINSIC
low complexity region	514	525	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200441

SMART Domains

Protein: ENSMUSP00000143231
Gene: ENSMUSG00000027751

Domain	Start	End	E-Value	Type
low complexity region	65	78	N/A	INTRINSIC
low complexity region	123	171	N/A	INTRINSIC
coiled coil region	213	242	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: The incompletely penetrant homozygous phenotype of a splice-site mutation may include retinal epithelium expansion over the dorsal half of the eye, exencephaly, spina bifida, gastrulation defects and/or aberrant somite and mesoderm development. A few mutants survive postnatally and appear normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	T	11: 110,144,274	I689K	probably damaging	Het
Agtpbp1	G	T	13: 59,462,088	T1076K	probably damaging	Het
Ammecr1l	A	G	18: 31,771,909	T68A	probably benign	Het
Arvcf	A	G	16: 18,397,715	E264G	probably damaging	Het
Cacna1b	C	T	2: 24,648,502	D1542N	probably damaging	Het
Cacna2d2	A	G	9: 107,515,196	T512A	probably damaging	Het
Crebbp	A	G	16: 4,107,492	C1213R	probably damaging	Het
Cybrd1	G	T	2: 71,118,223	R35L	probably damaging	Het
Dcaf1	G	A	9: 106,879,959	W1412*	probably null	Het
Eif4e	T	A	3: 138,547,734	D67E	probably benign	Het
Epb41	G	A	4: 131,974,851	T491I	probably damaging	Het
Fez1	G	A	9: 36,867,951	S308N	probably benign	Het
Fgfr3	A	G	5: 33,729,954	S206G	possibly damaging	Het
Flcn	A	T	11: 59,794,172	N484K	possibly damaging	Het
Gdap2	T	C	3: 100,182,755		probably null	Het
Gfpt1	T	A	6: 87,085,283	D541E	probably benign	Het
Gm38394	T	C	1: 133,657,277	D774G	probably damaging	Het
Gm5089	A	G	14: 122,436,192	F39S	unknown	Het
Gm7694	C	T	1: 170,302,604	G75D	probably benign	Het
Gpr15	A	G	16: 58,718,153	L191S	probably benign	Het
Hmcn1	T	G	1: 150,669,436	T2807P	probably damaging	Het
Iqgap2	T	C	13: 95,646,841	T1276A		Het
Itgae	G	T	11: 73,111,803	A129S	possibly damaging	Het
Kcns1	T	C	2: 164,168,458	E127G	probably damaging	Het
Kmt2b	T	C	7: 30,582,882	E1118G	probably damaging	Het
Lair1	T	C	7: 4,010,820	I143V	probably benign	Het
Lcmt2	T	C	2: 121,140,140	D154G	possibly damaging	Het
Ly9	T	C	1: 171,599,707	T427A	probably damaging	Het
Man2c1	A	G	9: 57,136,746	T281A	possibly damaging	Het
Map4k2	T	C	19: 6,344,485	F332L	probably benign	Het
Mmp10	A	T	9: 7,502,488	D32V	probably benign	Het
Naip2	T	A	13: 100,161,735	S598C	probably damaging	Het
Npnt	T	C	3: 132,906,355	N300S	probably benign	Het
Olfr1443	T	C	19: 12,680,348	V80A	probably benign	Het
Olfr178	G	A	16: 58,890,202	T6I	probably benign	Het
Olfr53	C	A	7: 140,652,350	R124S	probably damaging	Het
Pacsin1	T	C	17: 27,708,011	V387A	probably damaging	Het
Pald1	G	T	10: 61,343,153	A489E	probably benign	Het
Pcnx	G	T	12: 81,918,204	G382W	probably damaging	Het
Pde6b	T	A	5: 108,419,726	M294K	possibly damaging	Het
Phf20	T	C	2: 156,294,247	V662A	probably benign	Het
Plcg1	T	C	2: 160,761,356	I1149T	possibly damaging	Het
Prdx2	T	C	8: 84,970,567	S79P	probably damaging	Het
Rab19	T	C	6: 39,383,921	M1T	probably null	Het
Retn	T	G	8: 3,656,908	F44C	probably damaging	Het
Rp1	A	T	1: 4,243,618	W507R	unknown	Het
Rsf1	A	C	7: 97,664,558		probably null	Het
Ryr3	C	T	2: 112,670,666	E3561K	possibly damaging	Het
Scaf1	T	A	7: 45,003,292	Y1220F	unknown	Het
Sowahc	A	G	10: 59,222,669	K209R	probably benign	Het
Tenm4	A	G	7: 96,896,160	E2498G	probably benign	Het
Tet1	T	C	10: 62,839,156	N1047S	probably benign	Het
Thap1	CAGCATCTGCTCGGAGCA	CAGCA	8: 26,160,856		probably null	Het
Tldc1	A	T	8: 119,768,342	S226T	probably benign	Het
Tub	T	A	7: 109,027,058	I267N	probably damaging	Het
Uggt1	T	C	1: 36,184,426	E594G	probably benign	Het
Vmn2r104	T	A	17: 20,029,988	I674F	probably damaging	Het
Zcchc4	T	C	5: 52,796,622	S215P	probably benign	Het
Zfc3h1	T	G	10: 115,414,011	S1177A	possibly damaging	Het
Zfp646	G	A	7: 127,881,878	A1076T	probably damaging	Het
Zfp735	T	A	11: 73,711,197	Y322*	probably null	Het

Other mutations in Supt20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Supt20	APN	3	54715169	missense	probably damaging	0.98
IGL01781:Supt20	APN	3	54695205	start codon destroyed	probably null	0.47
IGL02510:Supt20	APN	3	54715524	intron	probably benign
IGL02656:Supt20	APN	3	54708395	missense	probably damaging	1.00
IGL02958:Supt20	APN	3	54713723	intron	probably benign
IGL03036:Supt20	APN	3	54709302	nonsense	probably null
IGL03128:Supt20	APN	3	54708287	missense	probably benign	0.05
IGL03164:Supt20	APN	3	54713188	missense	probably benign	0.01
FR4304:Supt20	UTSW	3	54727647	small insertion	probably benign
FR4304:Supt20	UTSW	3	54727662	small insertion	probably benign
FR4304:Supt20	UTSW	3	54727664	nonsense	probably null
FR4449:Supt20	UTSW	3	54727649	small insertion	probably benign
FR4548:Supt20	UTSW	3	54727657	small insertion	probably benign
FR4548:Supt20	UTSW	3	54727664	small insertion	probably benign
FR4548:Supt20	UTSW	3	54727673	small insertion	probably benign
FR4589:Supt20	UTSW	3	54727651	small insertion	probably benign
FR4589:Supt20	UTSW	3	54727655	small insertion	probably benign
FR4589:Supt20	UTSW	3	54727671	small insertion	probably benign
FR4737:Supt20	UTSW	3	54727657	small insertion	probably benign
FR4737:Supt20	UTSW	3	54727658	small insertion	probably benign
FR4737:Supt20	UTSW	3	54727661	small insertion	probably benign
R0383:Supt20	UTSW	3	54703149	nonsense	probably null
R0675:Supt20	UTSW	3	54706969	missense	probably damaging	1.00
R0744:Supt20	UTSW	3	54714701	missense	probably damaging	1.00
R0968:Supt20	UTSW	3	54708400	intron	probably benign
R1075:Supt20	UTSW	3	54706941	nonsense	probably null
R1689:Supt20	UTSW	3	54712162	nonsense	probably null
R1772:Supt20	UTSW	3	54710420	missense	probably damaging	1.00
R1779:Supt20	UTSW	3	54714743	missense	probably benign	0.00
R1829:Supt20	UTSW	3	54727658	utr 3 prime	probably benign
R3236:Supt20	UTSW	3	54709080	missense	possibly damaging	0.94
R3237:Supt20	UTSW	3	54709080	missense	possibly damaging	0.94
R4989:Supt20	UTSW	3	54695134	utr 5 prime	probably benign
R5180:Supt20	UTSW	3	54709085	missense	probably benign	0.00
R5188:Supt20	UTSW	3	54710428	missense	possibly damaging	0.87
R5423:Supt20	UTSW	3	54709325	missense	probably damaging	1.00
R5627:Supt20	UTSW	3	54713190	missense	possibly damaging	0.86
R5888:Supt20	UTSW	3	54712207	missense	probably benign
R5995:Supt20	UTSW	3	54709053	missense	probably damaging	0.97
R6316:Supt20	UTSW	3	54727648	small insertion	probably benign
R6623:Supt20	UTSW	3	54718294	missense	possibly damaging	0.93
R6713:Supt20	UTSW	3	54698601	missense	possibly damaging	0.89
R6874:Supt20	UTSW	3	54727754	splice site	probably null
R6988:Supt20	UTSW	3	54698597	missense	probably damaging	1.00
R7149:Supt20	UTSW	3	54728411	missense	unknown
R7592:Supt20	UTSW	3	54707122	missense	probably damaging	0.97
R7940:Supt20	UTSW	3	54713199	missense	probably benign	0.04
R8480:Supt20	UTSW	3	54707116	missense	probably damaging	1.00
R8550:Supt20	UTSW	3	54715642	missense	possibly damaging	0.48
R8935:Supt20	UTSW	3	54727567	critical splice acceptor site	probably null
R9412:Supt20	UTSW	3	54727648	small deletion	probably benign
RF001:Supt20	UTSW	3	54727662	small insertion	probably benign
RF009:Supt20	UTSW	3	54727662	small insertion	probably benign
RF010:Supt20	UTSW	3	54727662	small insertion	probably benign
RF014:Supt20	UTSW	3	54727665	small insertion	probably benign
RF026:Supt20	UTSW	3	54727647	small insertion	probably benign
RF026:Supt20	UTSW	3	54727670	nonsense	probably null
RF032:Supt20	UTSW	3	54727666	small insertion	probably benign
RF038:Supt20	UTSW	3	54727647	small insertion	probably benign
RF045:Supt20	UTSW	3	54727666	small insertion	probably benign
RF052:Supt20	UTSW	3	54727665	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGAGACTAAGCCTTTGAGCTGTG -3'
(R):5'- TAACCAGTGCCACAAAAGGG -3'

Sequencing Primer
(F):5'- AGTTCCAGTCACTTATGAGCTG -3'
(R):5'- GGCTGGCTTCAAACTTCCTTAAGATG -3'

Posted On

2022-05-16