Incidental Mutation 'R9414:Supt20'
ID 711927
Institutional Source Beutler Lab
Gene Symbol Supt20
Ensembl Gene ENSMUSG00000027751
Gene Name suppressor of Ty 20
Synonyms Fam48a, p38IP, D3Ertd300e, p38 interacting protein
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock # R9414 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 54692807-54728766 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 54703083 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 103 (I103N)
Ref Sequence ENSEMBL: ENSMUSP00000131454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029315] [ENSMUST00000170552] [ENSMUST00000197502] [ENSMUST00000199652] [ENSMUST00000199655] [ENSMUST00000199674] [ENSMUST00000200439] [ENSMUST00000200441]
AlphaFold Q7TT00
Predicted Effect probably benign
Transcript: ENSMUST00000029315
SMART Domains Protein: ENSMUSP00000029315
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 107 159 N/A INTRINSIC
coiled coil region 201 230 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170552
AA Change: I103N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131454
Gene: ENSMUSG00000027751
AA Change: I103N

DomainStartEndE-ValueType
Pfam:Spt20 63 229 6.8e-47 PFAM
low complexity region 425 441 N/A INTRINSIC
low complexity region 468 477 N/A INTRINSIC
low complexity region 488 502 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197502
AA Change: I102N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143750
Gene: ENSMUSG00000027751
AA Change: I102N

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 227 1.9e-43 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 512 532 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
low complexity region 632 680 N/A INTRINSIC
coiled coil region 722 751 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199652
AA Change: I102N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142648
Gene: ENSMUSG00000027751
AA Change: I102N

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 181 1.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199655
AA Change: I102N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143520
Gene: ENSMUSG00000027751
AA Change: I102N

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 140 5.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199674
AA Change: I102N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142948
Gene: ENSMUSG00000027751
AA Change: I102N

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 3.3e-39 PFAM
low complexity region 424 442 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200439
AA Change: I102N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143059
Gene: ENSMUSG00000027751
AA Change: I102N

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 2.7e-42 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200441
SMART Domains Protein: ENSMUSP00000143231
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 123 171 N/A INTRINSIC
coiled coil region 213 242 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: The incompletely penetrant homozygous phenotype of a splice-site mutation may include retinal epithelium expansion over the dorsal half of the eye, exencephaly, spina bifida, gastrulation defects and/or aberrant somite and mesoderm development. A few mutants survive postnatally and appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A T 11: 110,144,274 I689K probably damaging Het
Agtpbp1 G T 13: 59,462,088 T1076K probably damaging Het
Ammecr1l A G 18: 31,771,909 T68A probably benign Het
Arvcf A G 16: 18,397,715 E264G probably damaging Het
Cacna1b C T 2: 24,648,502 D1542N probably damaging Het
Cacna2d2 A G 9: 107,515,196 T512A probably damaging Het
Crebbp A G 16: 4,107,492 C1213R probably damaging Het
Cybrd1 G T 2: 71,118,223 R35L probably damaging Het
Dcaf1 G A 9: 106,879,959 W1412* probably null Het
Eif4e T A 3: 138,547,734 D67E probably benign Het
Epb41 G A 4: 131,974,851 T491I probably damaging Het
Fez1 G A 9: 36,867,951 S308N probably benign Het
Fgfr3 A G 5: 33,729,954 S206G possibly damaging Het
Flcn A T 11: 59,794,172 N484K possibly damaging Het
Gdap2 T C 3: 100,182,755 probably null Het
Gfpt1 T A 6: 87,085,283 D541E probably benign Het
Gm38394 T C 1: 133,657,277 D774G probably damaging Het
Gm5089 A G 14: 122,436,192 F39S unknown Het
Gm7694 C T 1: 170,302,604 G75D probably benign Het
Gpr15 A G 16: 58,718,153 L191S probably benign Het
Hmcn1 T G 1: 150,669,436 T2807P probably damaging Het
Iqgap2 T C 13: 95,646,841 T1276A Het
Itgae G T 11: 73,111,803 A129S possibly damaging Het
Kcns1 T C 2: 164,168,458 E127G probably damaging Het
Kmt2b T C 7: 30,582,882 E1118G probably damaging Het
Lair1 T C 7: 4,010,820 I143V probably benign Het
Lcmt2 T C 2: 121,140,140 D154G possibly damaging Het
Ly9 T C 1: 171,599,707 T427A probably damaging Het
Man2c1 A G 9: 57,136,746 T281A possibly damaging Het
Map4k2 T C 19: 6,344,485 F332L probably benign Het
Mmp10 A T 9: 7,502,488 D32V probably benign Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Npnt T C 3: 132,906,355 N300S probably benign Het
Olfr1443 T C 19: 12,680,348 V80A probably benign Het
Olfr178 G A 16: 58,890,202 T6I probably benign Het
Olfr53 C A 7: 140,652,350 R124S probably damaging Het
Pacsin1 T C 17: 27,708,011 V387A probably damaging Het
Pald1 G T 10: 61,343,153 A489E probably benign Het
Pcnx G T 12: 81,918,204 G382W probably damaging Het
Pde6b T A 5: 108,419,726 M294K possibly damaging Het
Phf20 T C 2: 156,294,247 V662A probably benign Het
Plcg1 T C 2: 160,761,356 I1149T possibly damaging Het
Prdx2 T C 8: 84,970,567 S79P probably damaging Het
Rab19 T C 6: 39,383,921 M1T probably null Het
Retn T G 8: 3,656,908 F44C probably damaging Het
Rp1 A T 1: 4,243,618 W507R unknown Het
Rsf1 A C 7: 97,664,558 probably null Het
Ryr3 C T 2: 112,670,666 E3561K possibly damaging Het
Scaf1 T A 7: 45,003,292 Y1220F unknown Het
Sowahc A G 10: 59,222,669 K209R probably benign Het
Tenm4 A G 7: 96,896,160 E2498G probably benign Het
Tet1 T C 10: 62,839,156 N1047S probably benign Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Tldc1 A T 8: 119,768,342 S226T probably benign Het
Tub T A 7: 109,027,058 I267N probably damaging Het
Uggt1 T C 1: 36,184,426 E594G probably benign Het
Vmn2r104 T A 17: 20,029,988 I674F probably damaging Het
Zcchc4 T C 5: 52,796,622 S215P probably benign Het
Zfc3h1 T G 10: 115,414,011 S1177A possibly damaging Het
Zfp646 G A 7: 127,881,878 A1076T probably damaging Het
Zfp735 T A 11: 73,711,197 Y322* probably null Het
Other mutations in Supt20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Supt20 APN 3 54715169 missense probably damaging 0.98
IGL01781:Supt20 APN 3 54695205 start codon destroyed probably null 0.47
IGL02510:Supt20 APN 3 54715524 intron probably benign
IGL02656:Supt20 APN 3 54708395 missense probably damaging 1.00
IGL02958:Supt20 APN 3 54713723 intron probably benign
IGL03036:Supt20 APN 3 54709302 nonsense probably null
IGL03128:Supt20 APN 3 54708287 missense probably benign 0.05
IGL03164:Supt20 APN 3 54713188 missense probably benign 0.01
FR4304:Supt20 UTSW 3 54727647 small insertion probably benign
FR4304:Supt20 UTSW 3 54727662 small insertion probably benign
FR4304:Supt20 UTSW 3 54727664 nonsense probably null
FR4449:Supt20 UTSW 3 54727649 small insertion probably benign
FR4548:Supt20 UTSW 3 54727657 small insertion probably benign
FR4548:Supt20 UTSW 3 54727664 small insertion probably benign
FR4548:Supt20 UTSW 3 54727673 small insertion probably benign
FR4589:Supt20 UTSW 3 54727651 small insertion probably benign
FR4589:Supt20 UTSW 3 54727655 small insertion probably benign
FR4589:Supt20 UTSW 3 54727671 small insertion probably benign
FR4737:Supt20 UTSW 3 54727657 small insertion probably benign
FR4737:Supt20 UTSW 3 54727658 small insertion probably benign
FR4737:Supt20 UTSW 3 54727661 small insertion probably benign
R0383:Supt20 UTSW 3 54703149 nonsense probably null
R0675:Supt20 UTSW 3 54706969 missense probably damaging 1.00
R0744:Supt20 UTSW 3 54714701 missense probably damaging 1.00
R0968:Supt20 UTSW 3 54708400 intron probably benign
R1075:Supt20 UTSW 3 54706941 nonsense probably null
R1689:Supt20 UTSW 3 54712162 nonsense probably null
R1772:Supt20 UTSW 3 54710420 missense probably damaging 1.00
R1779:Supt20 UTSW 3 54714743 missense probably benign 0.00
R1829:Supt20 UTSW 3 54727658 utr 3 prime probably benign
R3236:Supt20 UTSW 3 54709080 missense possibly damaging 0.94
R3237:Supt20 UTSW 3 54709080 missense possibly damaging 0.94
R4989:Supt20 UTSW 3 54695134 utr 5 prime probably benign
R5180:Supt20 UTSW 3 54709085 missense probably benign 0.00
R5188:Supt20 UTSW 3 54710428 missense possibly damaging 0.87
R5423:Supt20 UTSW 3 54709325 missense probably damaging 1.00
R5627:Supt20 UTSW 3 54713190 missense possibly damaging 0.86
R5888:Supt20 UTSW 3 54712207 missense probably benign
R5995:Supt20 UTSW 3 54709053 missense probably damaging 0.97
R6316:Supt20 UTSW 3 54727648 small insertion probably benign
R6623:Supt20 UTSW 3 54718294 missense possibly damaging 0.93
R6713:Supt20 UTSW 3 54698601 missense possibly damaging 0.89
R6874:Supt20 UTSW 3 54727754 splice site probably null
R6988:Supt20 UTSW 3 54698597 missense probably damaging 1.00
R7149:Supt20 UTSW 3 54728411 missense unknown
R7592:Supt20 UTSW 3 54707122 missense probably damaging 0.97
R7940:Supt20 UTSW 3 54713199 missense probably benign 0.04
R8480:Supt20 UTSW 3 54707116 missense probably damaging 1.00
R8550:Supt20 UTSW 3 54715642 missense possibly damaging 0.48
R8935:Supt20 UTSW 3 54727567 critical splice acceptor site probably null
R9412:Supt20 UTSW 3 54727648 small deletion probably benign
RF001:Supt20 UTSW 3 54727662 small insertion probably benign
RF009:Supt20 UTSW 3 54727662 small insertion probably benign
RF010:Supt20 UTSW 3 54727662 small insertion probably benign
RF014:Supt20 UTSW 3 54727665 small insertion probably benign
RF026:Supt20 UTSW 3 54727647 small insertion probably benign
RF026:Supt20 UTSW 3 54727670 nonsense probably null
RF032:Supt20 UTSW 3 54727666 small insertion probably benign
RF038:Supt20 UTSW 3 54727647 small insertion probably benign
RF045:Supt20 UTSW 3 54727666 small insertion probably benign
RF052:Supt20 UTSW 3 54727665 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATGAGACTAAGCCTTTGAGCTGTG -3'
(R):5'- TAACCAGTGCCACAAAAGGG -3'

Sequencing Primer
(F):5'- AGTTCCAGTCACTTATGAGCTG -3'
(R):5'- GGCTGGCTTCAAACTTCCTTAAGATG -3'
Posted On 2022-05-16